JFIF,,$ExifMM*1"V2xi JAdobe Photoshop CC 2018 (Windows)2019:06:14 11:38:170000s  2008:12:15 13:36:052008:12:15 13:36:05ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,@$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^u`dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋICC_PROFILE }xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|ICC_PROFILE } "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{ՑICC_PROFILE |{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{       # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrqqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmICC_PROFILE jmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJӖǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"ICC_PROFILE pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpaRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:ICC_PROFILE N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$ Adobe Photoshop CC 2018 (Windows)2008-12-15T13:36:05 CC {" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?I%?$۫zO2{(0(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((+)3Yo?kj'??ΙOdL`) (((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((+JJ~?mi[Oڇc_(IOSY'+'(C ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ҷR5ZVSf ?Itj (Š(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((ԧf֕|f5$|:e>O2{(0(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((+)3Yo?kj'??ΙOdL`) (((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((ހ +sگ k.D&|i>~#|c:*X67)ZX?E?5s>0~RuǞc 9T*񗽷F'2L rԔr_,{^Ty=~6~jm[u.?3o3ύ; X|+ݖ>W~sWXs Jt[jW(*_nGO_QrW4>(Qf>a^3Z<̿yaBT>"^w( |C<#*a8aj:8w֗,i9;ETv[imUzYU NU!-rfH6rpj,%9O\X^RuwӉ0nT=#9^яy;;-8z(} co4]v±i:UiӮS[hj14 ;)pH s^Og|A^Xl RHNKN\&Ȩ,VuBvR87s5w|Ew>voxwޡODnpop#\-vpOwwu2DfՎ4cynaʝx8J.2OW:?Z5(I]N2R]ԖtWӚ{PWPo Xi$+4Z^=+\YC.I9$0* snɱ>@L˞Of^+8OL41_Z|2NqK%-3,α35C:hsR3 ٮܷ+̳Tp9U ֬"'l3,)W1SWmeeWd*^<'C_ja?#ʹ{O=ĝR]~Q[ڛٴ./:xi@x_ q&00MӚ^_+^&v_<<,>*W~v8+dO\Njgߍ^ЮK$d֫Zv4xGX pNRUb$saτ1ufiԛQc^&J1Ro<~ǿ59kPmdLY'}Mz$|v4y<)m[Y۵~u8זi!o~+,Viy[VWNr[N5qg ex幖aF!ܝXFZ'NR2lIk)ñ?> |L.&W/5+ G]~jǢ̄ >ٯ//s,WBukKhB2=<~exYc*F;rQZ<<kڿ8V+=0(((+)3Yo?kj'??ΙOdL`) (((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((Cb?i Wi>oa h|CT|iw{CÚ5B6i#RDeLZv-3#t/^xf[y2ՆQC/իy|(¦*FM8j05'ke6c`Tcig2B5:ӧzrj_ԣyBQSIMs^&j-ݻ>k o]{^,τ<]6Pw7+4\ٹ?;=L~7FADr¶H\WYkß >/|Z7F Ú| P#<|E|(˫d88T9Wb({)΍9B֥)SqR>U.[ꏢf,*exƆ'_FTBXƢ8]ǚ3|0%'ԼM{G}mcux]-#RUQu%ݴg%#_m[ǫwVӮkkm2H<WǟW ?źoo~{Fۣ$ktۏ5-$x;*S=o0jSG[.TFy8IKqY^mT**sr8ԅZp\s.H7GCy\Nq֩ *sR^N~-O-gПH^,gW!x/vG~|_o|Zf;~. ֚іLkcí"om~7gwo2'; 1#Qr?h RЙYNSgOc_SW7. ?9OZ'[8b%.XZw8iR7>fOaQN<6aol-z,}y{jFQuĿ^%QMg+{}SH+Hvȸ q_Lj ke_3e+k4ῈXD:ӡ]ͥKRO?9++ ѴJ{GMo,oc-&NU9H+o SsNS˱'BJiڭҗƤ}+{9:>KSͰ5i·K*6JTDA?iXѼApa $ z'MyƬvG}u.Y,z3#Ԋ3 mjxXwNQU{J|Yr.W_]?d)TK]TsSJ<Ο,Rw|J\i%{/|obTKu :l_2 t8ѥCr+>)Xk0&{ 2K,ՊZ­(dM} ~,hP_x|98p*n !}UeэAVV1+_sU*1Tr:QƜd8R{{Y>ec 7,DJ?%N1[Q]?g=^Ï?猯&֭,<y'֠yxkVvHĺ:LnkL~;~6V[[x";脶޵+[Z# ԟIe; _xZե7(Y x4π_H5np_"F饴VmvfFicac)k)}O *Gw{:ҟR_ЧMpuGt~Z}%'&k(75{{\kw usS5qem %wB׵;9]|@&q1мn;>Hy5j/@|C "r\c_]RFn!Fb09OAfte=(VZ5.HT\+Lo/u{WOE[eTUug2ؑd Z>}xژNYF0 U9Ӕ$NRQ)$x>;3Sbሧ*J5S8Ԋ*8USk.gĴ%v公㻼5k06w25E&X&+xRaDWw`ρoe kkV¦C 63og?|v9cƙ 3̰Q.z 6ni%+YN[ܣeaя%:4]ҌcrrO7Gҧ5D%n5VIu&H~_z|pW~еsM/!f|{˫ʏ#8_4|7;&οw+h0OR [+q<C۞د>"x_!6qwiNt2i45ۻiVs'[!WW<%LVra5XrVk81)ENR7|ߎ\.[AF\Exb2>zr(U F<|is^?hWZƱcV3$w4Ϋn +$7 x#ƾ^.tk/?Ni)-%Y B "c?%߇7W߁~#3_ LmS[| ;ik/E5fG#ˎfTyEQOrㇱ5"5F*+(R:ьԄYE3N<_YћJ2+e)ԧ5%~isFKV]UǞ)<Z(0摾~,M{NMg xW6{)uIu;k ?|#meQWW5:/$~wQxY-Lk}yG%rt+gWy&vY\4wk:oE?t%[Z;)y/|}WYYvkmw," !~|-Z{/ kiq~(=Iqpxp+D_m[_ESQ55}ܼI<ôǽve\sR$iӥ4(I8i'R(ښ'*ls2Y dXW̱rR7ҕv,U[rӧFWF%ck#EhvOuskf[O ( 1cV~1!>8Ujoÿ xR>џVnRfs_=\]k^/ ^Kxĺf /nnd c0ս x'A%z_3w 얲OXx8NyewCzqIT%niCNfep C%sLBe%j8Rg)Iџw#ضƶm]| 6y8xiY?wWʞ)$b:5$>?k?'>"xMI_K~S@\.;Zܨb\kϊ~ _?T0-E'GYNX:T6|ӊOIT4[jXٔ3BO2'??ΙY=VERQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQERP/o߳_~Om7|A? .;{p#!a>lw|cZe&/nE}UnԯbSÒQ$NiM¤^{$\ZS>?358ʮ#\JuciNKXJڦ>o~q=xxŋ?Mߥacoσ|/@γu}Jxwq(x/ӥ|EmvOQJ9T(FM.h浥u(GCfdKkN$'f(ҥJ)YTg> bo-AxCtдu).S\:{sֳcw_}'-o5=x){ɮ$;T /k+gY^cZ:Ѩ:QBRiaTlRRNN~ҕIMi1~7G__:><)z?0,M3t2ɱIW>'(xVڍ74 C°],h;A# ^Exٟg u ƢRSKޣœck(1cʢ2:}7ӫNoݭ(N5ܧ)SRrmɽYkz}7qk:=jnj)e+)}ƿe|? t26` ^03/Exk[2R#)q䊋R;^UGieqiTOi.i9(Xǖ-VO3?߇.3rm5 QVdo)H?e?ZWo%f$#OOKy#3\a4<0,~J|19NSR`/i)8Ƣ\9ө 8.Y$̟,mf/1Zld#)Soq ozTghf#o? .τ}aujWNх,#O  1WN35pXY>kNfR7RpTT)E9Fk5N ;ӄN\*v:n5Uu%>oxU/:lӑ_Bҿ;Ǻ?|1mZ>54z orX"HʠR־~xO[b%JS[I_b2+55ok-oguqm{S|9-OyNn|!jRk>QnuNٸc-s1QWyTn?Үݥx&Rh^K-SU寍诨K [•Z*>US *Z)GJ'b V!1؜5D:ԌiS乩t:|n_r=#okGmsȑiU*"4U\5Q_f8[4j:''y7ϭ<G,aF0VьUBe!ъ:#U<ڟ/ o4'?ۚ?`]HePZŠ'aaNl-uRXS+e28J2WgRU'N)(ԇ2FQd(X^1k @?gt|IVůih QR\G1P~S{˭JPw9yZϸazOѣF6)s,S'hGLjUJեNQ`cBQ")IN/g |*gm;YLڄ ooj7cpq֖sc-thRpIyF+w. ߑԩQ>i9թ*mOh}ῌᯄ>"I!m_Ƴ> x;z׉|Nht+xJM Ku!Lu#QWq3,0g4aTepQ'$of\#̩,EhbɪxM{de v\ќ%ҕusvg'ž) :2xm9k?q5ԒYmOƞ(]>=Vm^]*6QX8(, YE5,6R4J.RU*N\IsMvk)Uͫb*q#:%N-B1 tf`ݕ(P`(((+)3Yo?kj'??ΙOdL`) (((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((+JJ~?mi[Oڇc_(IOSY'+'(C ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ҷR5ZVSf ?Itj (Š(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((ԧf֕|f5$|:e>O2{(0(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((+)3Yo?kj'??ΙOdL`) (((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((+JJ~?mi[Oڇc_(IOSY'+'(C ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ҷR5ZVSf ?Itj (Š(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((ԧf֕|f5$|:e>O2{(0(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((+)3Yo?kj'??ΙOdL`) (((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((+JJ~?mi[Oڇc_(IOSY'+'(C ( ( ( ( ( ( ( ( ( ( (6tZUy#N6'5tԫ% QDLEn]JWhM1mn[of$;^5?h-J(ԯ?lr-tim[?1bLJ ?FÞ9QK#WrK< :U+WO-AȵjK{=@.lVxXXTȪ5җQᾐ bO< eM4W~!x~Қ&F95ȣƾt~Md]-zbܠ{\~>yOF|//}Oq 8֓1o߁Ssd!D8taDe<Ɯ: tg؅QH(t?xMuV.qhԅ8G/l|NKbiF RP{8M?F=GGԪE5?J %}WȇGAd?#(CEct¢DI_?k!e/H+Q|Xc$,1Wn>.nKC?J %}WȇGAd?#(Y}I>-дcPմ :6cUt  䫃{,e9B[Qqvv;pؼ62T2RWtQM'ֽ ?e%᧏dDG"xREnUx sW˱oQKo+_8v NsJ13W.e/H+Q|Xc$,1Wn>.nKC?J %}WȇGAd?#(CEct¢DI_?k!e/H+Q|Xc$,1Wn>.nKC?J[܏)GQ^ %}|&'O"I ^-^ " =R?/-(xgZp^EJ.kϫP-jn/5*kǞ4!QE`j ( ( ( ( ( ( ( (5yHaI'#iS|Wi+w_ß |Q<R*؃[Ǹ} 9?haCO~桫'|/a6KyG>'7+nqIoZK݋rh-3 m&p1>amwӯ^$oŦ2vxbB?m}V& 96Ėp560_8Jj%%xQP0((NΫ˰Qw['Nx^Ytf/f5FU*=R~)(i[rQ&Q_hoA; 3]7Aה7^ҿqi9Ҳ|[͠` G+h{?9~sxNW' f}]#?iԏ +%OGII1GEKS|aѵKs:hc+#NuO%[u'J/k ~-:i-&M׈ īY?^;:r叴nG\JlNQ>{Ư+n[PE 9Wh4r"JO#ͳ6+}_5ԣSjBPtg~kf~b)֧hZ)K^iQEQH{{SZW{wEq,K%Ta]XG9ަEcu.ZUsO)"vx_2W¢DI_Cl|+7O^Ͽ "۹R=n\i早Z7ukylݶHeNyTMөInCӄR 7xS[4R6ql>|K 7u VWVqݒ9e#хqpQI-bo`*Ɯ^J+hCEct¢DI_WȜ۹R<ŏ&>?J %}WȇGAd?#(CEct¢DI_?k!e/H+Q|Xc$,1Wn>.nKC?J %}WȇGAd?#(B?,1wi1xc w\^u:ޙ6-ƒtk"FU$y>tEnEz+G/= ;,1Wno{>.nGC\t2QI\@'ҸqXnJ2'nv;0&2V3񒒿kQEtQ@SYI ;) ƞ3m'OBq+J% @&'Lx"x- F|j:Vw|x?CWyӥ9/ F߉yfT0JJM04m[ž 袻o%_]|\b2$ͯ0G?1jJ?s.Z'՟NGJ|}ߌZf}/'?O m&_1~>Ef1F穑~ٍO8rCgXj{EVdԿh\E5mwťgkBӯL%5f}QhQ@fM7}fS|SMO2PӼ9uyevEB25Մ1ӕ<TWb98&V4[],1WnT_? +7]}@5\w#_2W¢DI_?Q|Xc$}@5\2 $y,1WnT_? +7G o?D?r? !yEz*/L|ŏ&>?J[܏)GQ^ %}EctsCw#_2W¢DI_?Q|Xc$}@5\2 $y,1Wnw~*['5uE4ƻ ?1Fdg|6ҕ|V ڱ +TTpؚsON Q^iQ@Q@Q@Q@Q@Q@Q@Q@Q@Q@i[Oͭ+)3[Pk ?It|$|:ed5[QHaEPEPEPEPEPEPEPEPEP[𿈼esºE24>y8UK6Q{ϋ5'>Q6$HW;s_/x[{0[>RoH̲2k[V?rSi5xW6UzMѿO yc)m`v{{uԌ= 4ohOý: +Nnw66/Z'P0'?t5-qosgq52]V!h$Fy9ş |e90/*5_L4^N-30LLW(1d*rT%,٦J:()?N?p?<.qԊX.c ~W+t+שڇɟaEWgaEPEPEPEPEPŸQ6wI+w 1&o__ ~q^#!2&In=NQթڟ5FRe_sC##>4\VڧĿ|Qp\ƫIq/_z}xA VVYH 'Qy,h:֝X4%QHCN'#wuNZT/j/qhB((((  d[F\\;p9$TxbB0TE(hG<,0[ѨJ2Yyȏ9k7Fkzl+7Ra9 .APO9_O)/j4Þ--夁~XX2s__-ּӵ]WSw4,~r.X{ֿo<")啛Tmwu٨%vMߍY'd8 ʊNқTA-)rQE~~QV,5 ZJҬu-OR[-?OC#$WN4z$o&s8:oPv9'O}#-uj#u=nٿm }1?d;Cwkx奮XO?|O-sOֿKWb*(تT+ߢ;aЌ("em׶7qڔ]X El>Y7R\Ѻ=%o+ZG ?a o uOͭn#7Z}W׶nBu;dq߅jxXzk8F-_g'o^*X#UT}jNRK1b {tJ()R`zʖ,SC m 4N0K7ׁJReOfH]_L]/Tyfs% $9z25!33!GP9GƯ&<=޹{[oFce b5aVF^.Ow.c!Nԭ_H_׮=J~k1^*|Y±VrcY=U 7[腒Xjdž)kyIS򄥭9v:{מ},K(?X½>VsmS=:O +?r'qKf_MHhw(|e= ^|'K\{i8*˞{_\"VOs޳_xSZxȋR,vndYknth_fcl-m6T/W(%abF_;ʌiog)>x[.$e&TkG}h֊8`[]Gu ]7\ЯP e<20V=|&"x\T*A2VqѦ4jz8ᤥNiJ2ZET(((? x]WÀ1N3߱G_ \LU /%/N[`qՂ(sw]bʏg]b]35e6=XH~o/ QGZ3?‘p=OaUPʈ؞@OL w`om)6Cþ]᣸Ԕ?)X{Z@^(7=ItokJIiNoN_W'>xglYֲw:q֥Y,#I1>+"]$7N|7&qx^sXi;/~%||{,!c}*|sݓھ겲1K *Ï\B'0ì~=Y/wI1]'֩N'yWIQL]Ú}7I?)!죵WQoҊBB*0[(%VZZrݷvaF;\QEldQEU`U2U# Өj.x|$m-| Wz`K{e w|Ze"{=bi1A5o=([O?}M*u'(V7Kw*yQ~Z$_8IxC+jb?\?]*zM_%?_~dc(# ( ( ( ( ( j8-OCek !_pқLmCR)}*QEQEQEQEQEQEQEQEQEQEQEo?k6ԧmC1$Y')镓lQE!Q@Q@Q@Q@Q@Q@Q@Q@Rs@Loω|UwWI®2n\.뉗枲R+<:Ww /½KQ,-kk| R/ލ^eu<zoۻ⦱wۙl5p:QOa%a3=_/'$sK$_Ioy> ֩'MTY'N2,i^3KI88 q_S89QӥE7RQQrIGWb3RvVh|MrZx¶a(ʆI2Oů=|~XǷ_Xe_l{_6xW#/qfGR/59|>,>aTƔ??Go+~_*c֔="Jgqڽ}k5_3|qxWZj:=qnխuŽ$]˃АGJ-3-mxD-@lBxi m#MG9]|sN4l2ԄU"gRn-;J5^gCԕLͬ:ri.m=Jɴ(?(_AӾ(hikBiW FyU_|g6ټ{ 5,[fVG Rg'? X^42:waa,E'JrO/uHXC- pWGF-,A RIwHm"-K#Co_?_vA g?jQEYx⇀~zWm5)}VV+Uw2.km7c>}IWƟU%V,?VujKؿ_濉fNqO|}zq,hf=ko řaZEƟ\qVz5E'G5E'_4l__q [Ę? G5E'G5E'_4l_GNП `Ę? G5E'G5E'_4l_GNП `Ę? G5E'G5E'_4l_GNП `Ę? G߷7߃gxo_<;=rXg뇒TJI!s@U R󧊞&f+,x6ӣUR.Z|ܶ+Nc2 r\5*Vʯ5N^niFkQVN]^[x=?)"gosÇ˿M.+oElH=õ[GS~!'\nUndK)ÆuǷ_d -<~g9YO^u{7KR]?v¼ŌaFN-4di_߳o\dm bu6/W9F+$ǁm??᭿f,>??᭿f,>?_/Wbu;sB|'Vc6VP߳o\E߳o\E/|ѱ;sB|'Vc6VP߳o\E߳o\E/|ѱ;sB|'Vc6VP߳o\E~%;O7~"FCo XZIld-.H*k=i@NJ_I.&WW } 4XU9$)+{ϡ_G~e8rSN-v1w{+7ND'A}k? aOPo&#MH袊oh+3X Nk4:ٯ/g;`5^E_v@?Fūα2ܟIʕ:I"gO\j5jB Ҕn_n#?|s?kr m6aW/ʿq{{S/W'oVO) xVP߳o\E߳o\E/|ѱ;sB|'V1b+?{ڳvEmw1s_Q;k;D S %{W|KQҧK/PgI.䳕H#wM$x$*}}J7G} vTZʳЩO)Ӛ}?''88ju:?o? nlKT98|޿s|h?x۹j:l&ͷ>Ѻ0W;pOx\rln^Ho(c,ViJ{Fijr}d\ ӫȜGA??O]ӅE-48hw7cQr+Y~~#/4Oi3i̻D]["_(pn#!F+燩֝d_ E.$f>q=I4"ڥ??I+|- {cڷO#R>,vqne8:v+`1pNRdjJXԌe-.hӸQEtQ@Q@Q@[Ŀ a@Rn"]'gԵrMB̒1ld^v +c'en pW*24iSOE)WQL^':9K7 (ǒ/UjIsroF6rMjϷ|sQ<s>!cѧ~Mx)s//ů3ȑ ߥt,%sTVW1j+$gdx a)|8OϧlnŁ⮷0;n |t&V^񎞄,-]N_VW>(dgؤIVܢh3<⋡Ȱ/hœR%g> ~=Mk4{gYU7ݗhNN}+ӵ=GElm&NԴqm"0eeaQ_O?j.SNW%B@>?H,gup+48ThFWѩKHo0~Q<))<'NOTf.oz2n\NEn)np=~]J~ZkD] ^"ė\mme`{+I_@ş| j i/]x^=+e8*NKiz xm.MFHD)>Z~os?:L.UNO[24l>Z3_ HJ%NJhqTcXd2I_O_rú%o'5c'4rne#(zdwj7^}R?l]>͕n|Tc_ӽG+ooo yq[Ƌ#U(zW Œ6yU d=U֒!շZtO iLju}?DS}tс}5?(XxokǷi4h>Ϧ_I)>4П;2bHL͌ǸU;$׈ =Aeg]Lxhíj/FKl{#)6T$:6<>~ —ŋu+_ 9`_pom>'X]*cː= WºrK-cCMmd]P} ^ ҿ?|O5%!=t36;W'¼6gIbrQo3}NVWߒ_G3N]sZ94R)DZ3H`ƸO bv0Wc_VM"/{5'OJaHz~4^·? N_Kz-z?$/ Kzge?Bd 0t'/ɼ|}:t'/ɼ|}:WЋK,cb1}3*_jGEHp;^7z4Esq7%1̻fH#C+*ڧU?Lc9W0Ù"qη5>^ktoz2VI m6aQ m6aW|NП aic6VP߳o\E߳o\E/|ѱ;sB|'Vc6VP߳o\E߳o\E/|ѱ;sB|'Vc6VP߳o\E߳o\E/|ѱ;sB|'Vc6VOZ:_Q?oVM7Y:T,v5Ԏ@:/W|I)/+iQ(Iʟ\RVZ]qM* EZ8|./_^׳^kg|#I_o_Qӑ?n%?T4QE|QEpxeY~Ѽu{ *)k)#`*2++ 2_~xo> aޗ_6'[_ҿ'8bS*~>Sfx|gωj$ 4pT~nM^S)7Q'CAu_3G_ \LU f?/3H7~prQEc'˿/WJ]b]35e6=XH~o/ R|3G)bLʻ9sp(G̱rUa)5G7uq٨QNr{F1\ғI\|pxRO9c@0x+KLì߼u#  fX ~ zqW-X_PV0FĻw711=I&{~CY$SĴ֥f+lY23*Ma0'4)}EH{W#zU;=:kB Ws*?{~&|L_7Ci _J¿x}kk_5{y/|9Hi~^W#?(;g\$i׷̪FvvzגG)YF~%Ğ+bW _NV<9?onn4bl{o C#z58`"ծKT>4wi /4{b6ֿ/OxӀK7jR(??:dڧVd}ԟ?#Z}_F?Ys{a2yk5 & GI5 Y3 ȯu7ƝA$+e\鹺,?K,1xw aZ/3HIM(߬O~ +qV+ M9NЊQqITQc$H|VV+n 7+RWrwWG@+̾-|,/>]W,0ggWUt89JC#Wc`l l1zqdFZ4סחܫG2JzR(J2işz ohemlRbM~ӣ+ ]j W*FO%!\ sc>_:|h|{]_(I?yO)^!%~WJз7IV)~5~k\K=ҿMu~%g#+OEWZ~ Zٮvp\4,̫& V^_T6$'\y_xNg_Njڝ>Zܶ6닿{/YͫԥGԩO~[~ͿX|r[~ͿX|r_F5s?'oX^Ę? G5E'G5E'_4l_GNП `Ę? G5E'G5E'_4l_GNП `Ę? G5E'G5E'_4l_GNП `Ę? G5E'_?Q(_0.W Aߖ &֢EHQ@Q@Q@Q@Q@Q@Q@Q@Q@Q@i[Oͭ+)3[Pk ?It|$|:ed5[QHaEPEPEPEPEPEPEPEPMn)gp?ئٓS[D:LI̷ ¾> yAԼ)D\ͅYxW+o6^d84у8r_)Eg*d'gLm/V I{Hd(0+3n#{ÑO_͈Q=ȭo$SLeJ5K+7Rak{gSWB2~,~_22#m2}n E'xscOxwY`5/F7n2Wԕ]S _S *|FT)VRdҔed({/?ߙ'|]>UoN~7❆>Y'ҵ:rEaOgí?P[;AbW^v5. gf&t_("/͸r'l)QYѩ3*~ y>k~NORy:q־Ov]?-燴 _hX,n5H${I&mÎ +ي\=--/Ez`pqOc2(JPѸKߥ׈S pt8xN1RIIk,/#q4E}GK78B?jJ(+8YTkOœ%zx6EB5!%(EJ.wM8z Z(Oԏ%>/E~[,?|G޿R+:ɕ?ԿCAϿ0+ "/n?+ _n cW␷z^$MJujxј8EN`?E%^dEEMkI?>u> '_¿^x!5^$MfKWrsǹ 7ٮ$h5^$M¿Þ=hu> 'Hm$a뿰EE`Hed`pU4VM4NCŸ+xoO"_W?V,:qpcgÿ~T (Г+|6u_'v;fں+>5]8>=[iOp1w^LiOMHiٳ 3*aot$h5^$M¿_=hu> 'Gٮ$hܾCEMkI?>u> 'G>0r*o]ϥIkI?=/<{R4 (ERF*:ӝ?XjI'A}k p5 ȟ |1jGEW|A^GHoKWW{/;q_ٗr=.OB?q?>ʟ_qERQEWПOǍsĽ+Iޞd_}qt#ֽ3>pOUК$5=kGy.[YN##*Zp_XɭIQ}i:iƗs曪E]wGs Ѭȧѕ5_ = Eӯ. [s!=LkQpGP˸ MTɯz?칣?Ů3!y 冫:whi|Ŧ>z)WԵucSW>z?Dxjr"^KeUcB953_?S_ Ŭ| 7xi|.>_ݱ _?*[S2Үt[Kh1Z(Hkd~;W^$Zxe4 O6-?qs\(rpUxF9_r\O{6QS̝ >TM?5+o?im4w蚼r16 x?k8׾c4.c5vo74*59.[~'W [#8UokSyC_L~"w4Yhw^#Q]f$(񯗎+ COvP~wr[2@U0X{יA3|<623ޛLs#⼮YN{#>V-c.Vf~)oMK8B?j8@/> g_Og< i6 x?cGZ_|bz> K3%?usPAmskZŽKxZF جފBp kJb+JWyIݾ~J(ҍjъI/%ktq:*חzd;=5U+$7O_JS|#xU|7"*i%uvRfwi:ڿ8n _4i,<*OU^ww~ceW2N2qr:sH${~\뢾 ~7O\Qo𞸯s"P`$|R{?3W_!>|@Ĕz;d_?%ٿ?85vyX{|x/ɊN_#.z|j;_!?/g]70J?F?)!zG c?l/9_I-Sa޾k//s  &Lk}_ԟ&k_c}_ԟ&k__B/,7'EWL"_ΧCN,B+*lL y?j2[HtO;w W_-J~aw?jY=GVs *o]ϥIkI?.}/<{S}}/?O&]ϥI+Ϲ}9܆_y4}}/?O&a_}a4TfK_y4{ _sx!6@mnMҡw:Wl4ZK?;)+x7J(Ȟ-=5#+?S>+7Qmg^7c+?ᝪSVq{QApXJ:]=N1;Ox@M^QuݷrѶ::gϊ"//o>)XI_|~I?v78*+aH淸fh|r.e=9|_,[)攭 u+GK'ouscY^f^qUL灩ya G|Z4YFƷtEՍ30?k^E~޵~쑟Ge#j# V𿉾A*2yQow߀>/7M, 5KiϲNr(coأN/.?꿦*gb: 9ɸ2_fn2=X(?Om?5ߌ_,3_7&ŕһzfkl?z ?_/1@Cq_Kχ?s"Hw_uybgs_6|,kBxŚď2-9=- ϭ|_)q8O iv%}wXt%jSç6?9?@Q_P#}W[/1a -tݵu[r kγl.EbsR_\O&YoɰJԅ8rQ/F-oxM6(_U_DUiK,<4+OHj8?  1Q (TP(FWFhFWIte9VS؃h-+?OG/ZȟtMY9/-z)> !῁_MOƺΛ{X2=FKs'g P2k7~ܘդ|H߻<)`g\X|;ʆ'MԥQR˒J2j.RR쏢fI-_8ɸ-a:uiqJ2y~5~k\K=ҿMuyB_89O=Og#+OEW-J+=oz4EăZ;wOU¿P#傻g!ŋ5^$MfKWrǹ 7ٮ$h5^$M¿Þ=hu> 'Gٮ$hܾCEMkI?>u> 'G>0r*Soux8m$yR FE ( ( ( ( ( ( ( ( ( ( ҷR5ZVSf ?Itj (Š(((((((((?es|c+:o H4_YrZFn aǨR;kW47]Я=UK IX.#w++bv_Ȇ=ٟr%r9spEƘ[Kc!kӗcMIsBrի-䖱?~ G[f:oUzFvG3斾{GNemZFڴVUr7`^ }?"?x #Sӧ(?E6ynw DwH|$sJ:W<6J-LJdE24SEʂDqTjJ(qMYӺ8 wOOD𦦌rh7(5%fZvLd+4 }oIzs_ӓoMqnFioR+R_o%߀/xZ'W5[IßWğ?`t?65φ|bj~>*f*8+xׂmHrm@u CJO,o4w糿kKXu VO_GŸz]ů4 k]kaV\o f$P~%a[E,>⿅_;gy%ЋN*ז)&Tݏ )|V𹥯g+jON{ndkSJ(%>/E~[,?|G޿R+:ɕ?ԿCAϿ0+7QѴa#VR8|Q6QޤmW++УZZiJc)wqOgJM/? g >УZ˿K0R3'(cnB|B?Ak맢̻GK0R3'(cnB|B?Ak맢̻GK0R3'(cnB|B?Ck맢f[@if?? _0ݵ)n Kh|A Cmk ĿacP~q?l?91C6]!>#3\z~5uxSEo ITk_A""5ܸwXʁEW@=Es>w~Nwd$s] l>q%mK^9E6#'(cnB|B?Ak맢˿K1R3'(cnB|B?Ak맢̻GK0R3'(cnB|B?Ak맢̻GK0R3'(cnB|B?Ak맢̻GK0R3~.xk@ṵѭD*WNq;?lTo(!>+ja)b줿N-7^撯7'o\:<\/M|}_`t&&ӑ?Po&#MH袊oh+=bmj?E'؛}Z+[2znGSeG?#WS{#(B ( =袚؟%>]تz 2p5=qzCzhfjN1_gWRz*-sO>lBOZ(?n 6=SZcֺۿ%5Ҋk 2|lwl>i_ֿa ٣x׊I۵J?Yˀ3*/2OG+ ( ( (;_=x~P6wIoirwׅ3GnPQ}g*@2[w^׷| >&|>sw1u5|ƧL7eJ{*]tqI+kߏ~ SO*ey5MHԃқ鮰m_ʒF}k?0ZY\kx/ŲLJA2,w=HĆ+h%x&G e>ppkOEkQ]SK0Wx:z-_2eҋi)LR-Qc{E uJ60FGjZ(jFk^ި IwLׇx9[+B_; q?(ӗ{_>K%,1FH2G柌?u_ x^yV 2i t"64R;:7]Վ M~`t_/у#.L_H~IovqU3S_cԿj1Z7?sSrZjojaxȮxfO ~U'|w7]69nm35QV^!>1{xጓf[Mng %`3쒧rk)(դԂ:-/ g4KH˵9ZO%2>(b50~vH9u+p~tuJ7`ַ,WLw4c5abh(QTt >W(vkWR 0cX g[V)JOaHN-!w2??"~I\1[j^"4ok ~Tѯj:È>XrmR ~cc:}$񕱞5g:p_*q_~ dpROUIQ_Q@Q@QE(.(w`ni/i/~?/g]q3H`ƿެE_%~k#LO|iiOƽ#n1ůG]})aZIo_5_?ˀ `5O_x5dMu屾O_x5dMuꯡYNbgTԏw+&?ΐ<5\=PU^Ip(2:[VUhPGiWB\$/&s3 O?Q-tW?f]@#GGaAg1O?Q-3 OEٙwaAg1O?Q-3 OEٙwaAg1O?Q-3 OEٙwaAgLo!oh+ḥKjFapUdy*l?οL"؋⿓na| XzqR_jcab2ԔR5;{?%JK?sWeGND%?T4QE|㿴'?~(o?]{x$G,yr>?"knWض! T/C:+.29"^/үڅeiWSXjZu^^[{icmÜ+kĬ,Y\ߖ;5iE̬xZfFU%QQmof_*I?>1i~Kf{koV!mK藺c} =uK', ę_ihdJ/ݒAqO fbxw<4e%_X{}Sq_춿5'i~ xNɞ17S,qnd=O#~YT0Aro8g/FtڄR=F,〸 ZٜN]%Z$2VRFHAWg-~>ӈw/wx/xzCGes~hs xyj/RjG_s^O3lWU{T/IhGQ'CAu_3G_ \LU f?/3H e?zQE .kY_+foOMw+vc!ɿ̿2_b8V>57hf_vvx:I.r7*?fTU,Ǭyk5.9ͫX[}6UҙQE!ϭ~oM|G./CУ;[ľ4IyZ4M!=9_UVx+"v7u3>[{}H|Ul9ztcJ/L!Y^*Ν9ԏM~*E _B(EPEP`zRE`QE; 1E]Wɯr_.T?Jc5.Ku%&,QEG곋S@u+X༜(軝I'ڢFxW{5ҕj%FN2#'(cnB|B?Ak맢2:/9B|B?Ak'(cnz(˿?/9B|B?Ak'(cnz(˿?/9B|B?Ak'(cnz(˿?/<~ |~dO e4kG]2 \.nx]H?xtxEIb>nOua7&.{C F"zݷҷr(@((((((((((+)3Yo?kj'??ΙOdL`) ((((((((((y"{K[|7V5G]H#>?ï"Lƹە#KL_6|É15d\Q\3wRPZ38N RVgoNd~G X I@ԍAz#S=wHwq׸EG)1_dJrx3"(K&~1|ͥ)/OK'8O_|Pl]Q -O(|?kBg<'sY:ׁ~0jx^to*'l$(n!?4n=W?x/)4K䕹̑xCF5nʬI7o+}K+A u0?< xOgڰdq]*&&:k2pYYӍL=Xԣ%f;rcy}ISJQ%iFQwM?##u2'u:iF[Y}딯џ)m'b%񧅣7i#[r9F'Ԏ:8Z:ZQOpq?8tc)%ډy)XX.c ~WIwHm"ߣ\KN?oLMS (k?<?-<3zYOL KwSk}7Jׄ=k*+xTjLؿ_濈hLo<FiJ|'~Ynw¾#pLuzUJ\i>U7nh]o?Z?f+^bu6/Wʿv8xOL5Ek^V'_>4l_GNЯ `ę/ 1_K?kٿׄ=hxOֿ}hؿ_>^*3_b O׿ zq=>-HgAx#bu6/W|Wʿ?LPxB%֥mZƝZ?mvgm27pXgjL ctJZF3ZuF"JKdIͥ}lrY&OɨIʞ:QrݪpvFCŸ+xoO"_W?V,:qpcÿ~T (ГalnׄxMoT߈%kJ4K4͜ˍ،׼g8濗[aڹc>>,g^ 9ɰNofNk%)]r. ^McrR(|2 {7Z׿ z|gNЯ aOg4/@?f+^o?Za/Wbu;}B'Ug4/@?f+^o?Za/Wbu?v8xO$ρi_<^V'G5Ek_F4q WIi~0C^W\ռ6m6Iuy' mEp mPrA)/,g>.gl:ӣR?d>k8JW|ғ,('d6"ju{Vr>X˖1VB<\/M|}_`t& aOS6b?ԏ(&薯\#$_w%%/{/%6]_ȟʄp*}2?q?>=Š( (9KHN>~)s/t&?w?U=k'7g\W^"Vejl-a%}3MW"s"׍*NӕX䳉@S^1texƪ !J_4QE~~:|kǧ˟w G75Jg@R9Iygo!aXi/?@mc_Я韙Cq)T?&Q?_jTK(/Oÿw'( M Mnm1bybA7 OU PFiPXrwM"ϙ-x67-.^nU/zJ1J=]Q_ $ c| ߍePc8?b?C3Z{WW;Oo(Wg[OB0=)}|ayGeOC9B5q p'ȿKZ#G!}*[^f3 e!zOdЖ]az2h4#Z:)+뾫j;_!?/g]70J?.T3?_xfoOl:eK7/,RM?h/l.0ÙzG:y:Qkٿׄ=hxOֿ}hؿ_濎v8xOo>+) {7Z׿ z|+_X&| CLWRo?Z?f+^bu6/W'cWʿ?L5Ek^V'_>4l_GNЯ `ę/ 1_K?_wxfSڇ5++xk95̠Wp3'Γbu}~:o\NiQ3}5;w政G>d᱘\Vq29tRJܱ+g?/_wRWW^k+"}-=5#+?Q6E*Ho?Y$O} UE9V/ҟL/ҟ_pBW7PF߂A?? zL~ 3 ]~]}7[&Z,Z6qd(4&{4>酉㌧NxJ2eVԓ[AEW|iɮbe޿m?5ߌ_,3__gNW`qՏi&2XnRč>mo鑨˴{ ܢȿ*<xadO7ʟ"rGtw̓7Nq&7>ǭѻ 8`F6֝_cVv?ـ)QEQEQ_V~t e߆|G6k/ATԮtܫ  ~ñs_E~GGpO ('Rr[_g+G|,'NomN-Nn[Kݔ]yxƿoZt9^<^jڟ׿ z {7Z0|ѱq W&| CLWRo?Z?f+^bu6/W'cWʿ?L5Ek^V'_>4l_GNЯ `ę/ 1_K?kٿׄ=hxOֿ}hؿ_>^*3_b LZk:zմ<&\i70\4.ܞNA40?1v':S_xV{30/\N[sJ[rcO |%:KYb]7/i>kr;߰QEQEQEQEQEQEQEQEQEQEQEVҷR5ƿPdLOVOsUQEQEQEQEQEQEQEQEQE[]ZE2%Es쮭o"'̳z[VYS&FRW^WʼjNIM;>c gb[`?QgmxO}ig zxFբm෸o|%8+Go|DZ/ j&V>{^M$HWHe oL;cR08F_t^dtJT?vu'8gIwHm"-K#Co_}?_vu} g?jQEYUQM_gQM_H},j;`_E39|Q_?(QE(sROƿ ȭYLG#EW{/;14c?F{̿w")ȳ?>?GQE i8p=$FI\??]!hE;D0OM >|C:s, L\%GrM@?쩠~~K}s&n,aFD@|G???_FTzrRY]:mS]CD|<S84SMOja9v=Z~z," 'ÚEavj[,MtTT_z8\=<6*4U^Iz5Iʤ۔Z i':_OtK[bҴ>mOREkUI*URV\oDݷJJ#JyݒZD?T&/ mgG_ i>+Ls ѿGQ_"KWĻό|oȱ[]*S ' ,^]_g`lۉJjjz:~bߛ?ٯ xJ\ W5cjԩ'SnOr^H((()pkrVF8U;\r!̾40 JnNfRД/xq21||\jQNT8ǕF}TR)kc(.+>x\e^4/&$VVhdĎG}k'D{u ^u I)KoUE'&kW04>o:%2[WO"O;S|>ϕ_)TiiagwݠDWjU,mb;xbB}*hAU+8:t(Čc[_R/̘޿rਾ('$YM׈ntydvǦW_'CJt]KF?&q?ԏn*u*F"vT$~2> .gඣD%>oks~x5c=CmVZWQ)] O"g#c%zSGqWgqg\s+|=EוkFVWN^p-~+0mS}9eZ>rH=E$;;Ú߅u.6Jn{+eXUR[**uqmym/cſC{ohwa!kKLk&ӏ2'U+J'xLVS *u`e'EOf+ 0xJ9(/2Og-}QEsSi!yb4U$UF2cbUرC=[DȶDG`X c|' REMa"2\3\jKj6s:77ꗗ~yk OWGNk1zU<@.*90(SI=c)(o;0eKReS F|wHӋQv֎V>(+h/2C-n-45_r[irF1)(ែMi|Kⓘ_ݛ/jn3f[ٺt\|,7"e$#z^5*RT}dS{$^IX#w1=?E]BZ qs?E]BZۯzF~?/g]q3H`ƿތE_%k#LO|iiOƽ#n1ůG]})aZIo_5_?ˀ `5O_x5dMu屾O_x5dMuꯡYNbgTԏw+&?ΑCS !'St?!OnҿO(OY􊿒iGMW?~t?[Oaψ袊-laEQ` (QEX3zHs{_%x{?%JN +?r'Kf_MHhw+h?"?Mfw#GkxI<AUeGNDU#D? cǵ-V|}tG[w^H՘c<+Bk)p )VFdt`v2Ob=k Cf=̛d=cj<#VP)ƗS[Z`IP~_T}(uN+o]'n/0`mxQ59t-ȓ#iAV94{t95[x̾5=^]S0wޯSs6a0W:xj~Ε>iO=)Y=eQE{|iɮbe޿m?5ߌ_,3__gNW`qՏi&2zJjX|AY|Fƚ,/&WZ_(|p4FV vnqz{_Z2q%yZ*rUc'%Nj!>:4zmTEGLh#T;Wnӵ;(쮡`\2, ֝ԪӯN5;٧?ƚFTVѮt X'TGD1Ȏոe`x 1RR7#\j̔wG;_|!Z%O xy(d9BQWTe-])*Om(_3S?˗ôr<ֲu'gZ1VU_KXܭYE <㧵-4eŠ(4) $M=I?~~ǟV/W>!L.|}iW/Y"VKW?9uf[ܧ-GUx(QWک.)~$ÿ~9׬&K#6Omź=7jko Ko1.D];1Vp'xS-֞ <-7)7/+8qsx)t^nJ=# Ph5ck 飂GgSbWoKx7 ZoZÖϙGGu࢟'=:EOf}A^H}b1 Ъ:5>iK4'x*-ҥn[EƜbulaOΝKU$)~5~k\K=ҿMua%&,QEGK,@ҫk<*}15G?Grտ8QEv?(QE(,ER(((((((((((+)3Yo?kj'??ΙOdL`) (((((((()Q׊Z(?M0]uRS/7آ-ΙpdHFd>ҿIA_%-}K˽mu{Y8luW\  lg?xڄrƱ<: ['PAÑ_ok쿋8NfsL9#=jЏ(th;.Gslw Un3跕%&kY]I{{]?e_ب jZ?ך1[@i/`֭G;RBF٣d-})I=kϸ{%|Ma_ ?IYG<5S2Tb~q}b?e`n.%ij\l򫬟-gkyKhS|#UG[.,󿡿yW+b01g!)}gM//9 >*jP&}Yᚿh3;0'Eird$26Q& ҕ{݀zj0aWD*_beR#}3xtpN2Y~?0s][^|U^-\5Ə֮y)\W~C[?xEF-0 Iҁ p\xg%iVVs;(B1O<'bF䤟~Ug7&0+S]{]Ӽ5j nt[ 5+Ƞi$c-i2¯$3Ey׶~3WZ|=ksƾ$Y6މep̠'L|0JcQm'O&qE/TRV*whGK6"?xxMwYM>&;g˶{,jWR0=jZ3Lf8.jէ*yII?ج/9} Z4aph*1_$%>/E~[,?|G޿R+:ɕ?ԿCAϿ0+:~^4Fv/㰔m7`+0?~ GoK_gyLrzTRq*n ] 47'yi?=?߳|AŽg~Ο ;Fк+oz|Z?vG;;t?Q5~G@?Ovw?_j?߳|AŽ.?ADF~zógO#Q?v_tQ/'p,?6E+3~ |+1f6uńyI_W゜>51ڣ1_5},K;TgSiǕ9{J~vI|/pN;ʘ8FU%}9r+b]^[x=?)"gA"~krb*Q_I 1y Oxk^+d5Aamd&(o.3nWZ*$ip=?)QFVם.Np:)S+n+?vG;;t?Q5~E|o@?6E+3:(vw?_j @?Ovw?_j?߳|AŽ.?ADF~zógO#Q?v_tQ/'p,?6E+3:(3muoxMnM?Xjg\q(YcL.>)J/w+V'8ܞbZIJv?v8O) ھ# Vn4[=o&~b_a~t&>`: _ ȟ۾(ɷϿHQExÚ<9x[V7 kteCq̥[k@8]!XhR煯*sN2OgOa׆&jAENF~y;s018??v_@b-^Amx{ _-_N ~zógO#Q?v_tSo/-AMYO<~oKW{fw'W:`Hy?F"΢~ xS^©-F2Үl_>)cVÞ hZVcʻUN?[FsO-~CC F8|=8ƜUbIvIh+׭*9j&oͽXc8NM-8=xǥjݑFb:}+W 9Jcj*ڮE#NHtZNvFu>Yx 4L.h#uljzjƱ}sڭ욆ff$1[591p~!OUrbA41ޤcq^.ᅤ*(w^}#?Җ+?ДQEQEQEgKE~4>1xk^ I\mm/J.xj1ĨԊQVqJ2fJ>ƢW2wW?uZywo3xzO @pMƧxL>da|רQ̲̿8sJ1e J2]z3.qF:eV,E7N2GĿ%.n/>xNtm&SjVu こ ?^iXԂ6?S5L?^k8br_٧QJ(Ԍ#W [xP2T1_j7NPq4~p9o>Gc?dKU#=8,kXA}O 0:cJJ_BN Nj%Dz4WQSRee.U_̿33?MO#oj!V]kW DJ0߀_OoHVy^ĩSUXԱ #&떍myg(<k*i`xu'ˏ9l8sĜCUB5~Ip_jRY;E6}of{ǼÊjWiT1^E^M'{b+/G>oj'3P{p!zthYFfVo$IWx|Oؚ]"+#w `c-`Y5Izrb^A8"S'-k?i~gy%vyئ~u xq_ύu FuYo?ji!z'/ *pzT񔟴b+k/vvR?9NH88_߂h-y|9*F) n 5֞<|ɜ0[$?1dsFzw~e{y9lp򣊤(oQ{J22%cKE} QS?G?/ Hg>gO\&y>|D[gFm15wd@=E~axw~&a{Xa 3FM_Ya9bOSG&7rLi֍=%9ɨ)yG*ʳG,hʶ"a)IHO_|1CoGFu2שO` 1<#> .XD p쨸P+?hO/_:>XC C+5~vy}@cH_jxG/9IgZKB?f7g4.ͭ,kUJ;1}lSkNOdЖNOdЖ>{֯ÿ';L+;؝ Փȣ ^/iҘR-!פp3a޾k?l/9_I- B;Gp/a5IoiN75IoiNU"9X؟_L#r QE1qnؗƿ_ANj^lml.H!k ws_`R b{WpԔ*+I&R{8O,ˆ0؇:r哋qn7bG;;t?Q5~ GoE|O@??6E+3:(vw?_j ~;aů(1_1~ GoógO#W] 7 -Ag~Ο ;F:(B _NXmk W g3gL Vmwam=Xx RI|IyyG~`H<&]j~DUx㾣gvxo\9rj1T.ZjkoDr<+u9wFה#񺽟s{_%x{?%J87J(ȟ-=5#+?Q6E*Ho?Y$O} UE9V/ҟL/ҟ_p([~&i(֡>wi6с J+l>"18y8ԃRMj}3F"SqZiOt?eC[46~,;h{+|YnW}1_~& Ldym:1\fl/p|/ |R~ _Ǩh@{l d+/b|keK:*EaTKᖻI#Ax7[^ Ot{ʌ2;(O`(OMw+viɮbe޿2?p?CO7KLP CҖ4^g7!4Q 1oMzo4c8֐viXMΛqڍ)mAS~~ȟjO/ě=}-Ԥ[i~2U\yNsW#8F~^>qnÞ1(bZjvH+(є#ӿG^#1!|5KJ+ާ7VVN/^gL N;t*jH' /_+Cþ9=&`qmA4 oOhsc0XL Sf(*Q}%tשфbxISx2qZ+49/ yFwn8drxvڗ )ǩu&xO_O%#2fyCh˓F ؉"^nqԋ4/To|ǫ_x9{sXʖWNKW wKKK_~?g>;Lּum]9H~]26>R㳿ovjzLsA9a昌5bkNSڔYr|+0VьU=ҿMu2Wɯr_.뿡/?L7gGLV>+2?5_oǏEoacUtm^+_&'E%#s¾x\⧇r|_vw?_j?߳|AŽ.o~;gmk W g;;t?Q5~ GoE w #o_Pbc?=?߳|AŽg~Ο ;Fк(o|Z?vG;;t?Q5~G@?C'?N;GoKW_|5Y/uM sS.8AV$~WDźbq&7?J/iYKУN.-(Vt~o)r)e1U)u~xbOSۼ%VIǀ|!OӠڢk?/l/ UocL.a4F_کZROܦ},@vS^g5fW񏌴*4.*!,ϵ}ǟe^Hxl'-vݵ0y|#<Q0W=, hKEk_i۾i=F mUWz~՟ROL5Gҗ8ܯ3l..x<d“nrZ/iu?Q1qqe9V/ >"jQISIB1h}zMz~՟ROL4z~՟ROL5'Nt;+9$_ͷ7YE.$3G7YE.$3GNt?N39kt)[Efx;J3Rߢgqj Vy}yj(7ԩq] ^ I*u7^ i$KO@0+cvz?.S}%T|om寉x{RfuٴorFU9/#̡_iI}M=R?s_mIgF**zߩgE~OU_Ɂ*el;=AG,Ko*/@n+&ODѭgA bR_HPG~1dU_eNLYE~oG_*UωR>U¶1헏^Es> RNEG_+?I]S (aCNSג ㋑*xWwOkSj'E` _9(<uY-:5GلQ}jV91 amLU猴O[oH/P\CnCۓMm7&mtzC'VMS\R=GYg;5k5;#7_w['Ntx'+VJ(Ay89JK˞'5ͫTn4)ӧ֞.r~^Ҥc5/ #|Im{o7>g mu}^xcoȋ#8_G, fZI$crjs(~;'K5 O|rҤ ^8`UՑFv.^g~SQj37?8S*\7R:o}2Gu~'`5(֋_>G_14x˗ɯkQ\_)E~mEA cS۰:O*5RSÿn.n+=x:a)'#_+:+U|8#Fo}@ӕlW ⫀OFs Ao0Nx+ѮVO=̿6a(:q}jU zS%?iOMV?XBmWPv?9f?5x|hVSm|%d?ٸ(>|x_E~&uj2{3jw'?H`WW59Rܮj'^J,\%x3g:4„eRo˚JS?c7L;w|znnzmGmȟ@\~ 981Z9$H;*\gwn#qmNOܣHznR?8nڇ' `]JO~gouv 1Š(B,dЖ:"jFOw$'iCv5鿷/C:]halⰳ_MɆX],*֮z~՟ROL5eL 8j,o4#xVS`g)I~Y_&m?j)p'Cz~|g\=xDŽ}wsMR^H|J5*JQjzٽO;FKY~Mu(PNN7rN1|IKD#}G_9> |>yu5lGѼ+ç^Ҵ#>mQhdh6G,s_}s8W'^p{O Z6}J/ދ_v^Y ՝Kqkso*nч0 */?h{L𯆾&j:ٴ)mo.fshQZ2hF@<;{ OkV۩y5KQݙ<4I>xB'eW0y'֥N,B'ZRyU:5i}Oʊm?j)p'??j)p'q.4'%v VsIooOڳ\IfoOڳ\If/ @ĜxA/[&m?j)p'??j)p'?t/w q_`eog?+?h?hq.4Iljhzgzg'K?'%v VsIooOڳ\IfoOڳ\If/ @ĜxA/[&,??N~q3| VK =3וS>1|jӴ'W޶@=meٷD[;_KuiyNF&eRU!?yƴ{E~_я \^x|<)F깴>y-+ ( ( ( ( ( ( ( ( ( ( ҷR5ZVSf ?Itj (Š((((((((((((Q@QE(ǵQv`~]=hQEQEZ(vEQvEQvEQvEQvEQvEQvERhw`QE`QE`QE`QE`QE`QE`QE+QEQE(.(.(.(W`c(Q@Q@Q@Q@Q@Q@Q@Q@QE)0=>ihvItR(QEQE((((:EQE\((QE(((((((.(w`QE`QE`QE`QE`QE`-EPEPEPEPEPEPEPEPEPEPEPEPEPGQp ?tQE(QvIZZ)݀QE(((.(w`QE`QE`QE`QE`QE`~QH(((((((((((ԧf֕|f5$|:e>O2{(0(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((+)3Yo?kj'??ΙOdL`) (((((((((({~>2cߊ/um?DἒD}N3ok4崑Ș-<޿X? xci_WxZ)aQ|4c=KIj~EǞ7p<*U"tUrSs\O{~Q_럁8|UΗî~W:g WĢx@?|O+AE~î~W:g QC_GJ'C?l<"_~Q_럁8|UΙî~W:g Q/"W.~x⢶z2oRX|4Xir'8yxk pqFuӓtI*JO)>M !9:/W|}Vo lorY_ HG̭5e9f+:0>εz .jQEv83\ xڣBNrWd<Kπ>*:֗__#?k눯%gC_G:Gs?Ol<"_~Q_럁8|UΙî~W:g Q/"W:Gs럁8|UΙĢx@?|C&%gC_G:Gs(2=+AE~î~W:g W Ow|M@.u[855%HdW#\o?;ӌ+W1:0Jo qغX,=zҤKY4^V*f_G`QM&/_M jV0" ՁG#pY6m.uaN2b83<,p53, x|S(+Ri'_lQ[W{;|~ M6>oۧD ?#U -5xT&'ǗEP=C>,T_0 _J/?j[N/J rj_%Ӵ?*X.fgsXAE7V^ Ob/[ÿRDžۨhLrեLo|]A'I?ZE5̨ǗĘXTeE/UUaxs8w ~g޲vH׵O_e9I;*iZ^>~({~^"YqDž|EuhC3I㾆|w2x*L ???p3(DM_K +s#9?u>*L ?Q!aW3\t@_|)Ģ3iׅL2F<Ck]"6F"L."SB14))3 (5 ( ) ϥ~~_~:|<Wna}K][X6-Ծumr+\<=T2撌c)Iڊ&o<=G.!ju(rǚRbvN_gG</wolkZa |Ldfh57gum7MlOX|;'d[s&̸2f/?_޼b?f,&ͳl2ܗ :0NO݊lL+0S̳D(aNYIߡ<џLk ">%LHi?Yk.j_OḀIIVy;yfA(Gp#ŬkAJ5~Rg+<(*ʆ ldUeM?X#i^pdPE'ڭ y5GgY<sI͚iwR/f;"O K$?Lm2&zǖ_S_*T7Ѥip؁1Z?5gE;l mM:&jHJ#NC_0^#'aqQp9SʾV ,g%-? j>4_\AH|NT !0¹sx(q6{),-^gKޔ`W0xqoj+(g%}0E9hx/1Q4}j[B+8ۇMJO [3BO2'??ΙY=VERQEQEQEQEQEQEQEQEQEG Ie?lx?x̺/lcԡ+!Y!@EdY#|>}OM _48[.+0^7RTBXFqn2-bFGwx\6;+Kt=@d&c,m_ߏ3'TڗuWO7 Zى'b95b? ošޝO j&\֛XL`NAR:x 89O,ʓR[vSmڗ֩}7j'S?&xCoV_Їmڗ֩}7j'S#U0opKG>j'mڗ֩}7:(?U[Їmڗ֩}7j'S#U0opKG>j'uGE'fi%NqrdqAhGuʕ\(f&M=\2wF,Xj)inN($Nik?fτ|l/ȏ=C @`j'qqsb+ԍ8.WSslCs\zRr.gi}_~ĭe,'|Tvoм> Z2H[@ !M~??~!R #žL- V׹**ȯ;goto]JcV7M&6a6OKp;7 ᡈ\o*Z[ҥ{&mIxQX1V8?Xӧw>Z6Vq{6quao4|Y]sē/ :g ɏW-rH+}U}~k;˂&TQWz+{X+ʷfէ.7 KҜ9`g ]Q,)NQ*u_IO&bK/=̗.Ry$jZ+Zܟ}W*厈}Z0{I-$-.AR z?hO'KZt18uXTܯgWxeq+*TQm*u% }i~cypS{Ƥ#8M৞#Ҿ6xbZda,l~m<*QO/?vWhu4sE,+u \2I%黣l c_ʶ{Ay񵿈=4׾8|_I%@C|T h 2 ]x/5}T*-/-?}ӝi/YeB\A~RNiTuuOU￵]|og׾_]lNST6#v$*NyS~v|EXZ> u;aiOx41=C2g\eu# k?hσ-xRgҭ/fmZՋwds蚸>^ e|3ÜAϥeq.(jTrU/_ u"oں#ϛˏ#O<ͼ``+pG8W^1e^dV{wS.߹Q>i |pgF4 }IZ [nFWF^?#5/14Kbvե̓cXⅅ~1~2⏂6ƪ{kqC޽g cd:/-&Ծ |BcLq^H{w?gÎyOA]^&ҧ.)zrTcYG*No jT;g51ae~Xy>m??_斿3lQEQE~0@?v/ kIqR˧]]CtCy_f%FQʃ3_0ɝT#~ jA:㲿meK Vq$8iI^2L N2' PT%i( RY?O=ߵ/So#tWDª{ }Y RZ?O=ߵ/So#tQ3& = h՟ߵ/So# RZ?O=|E hVz))6S'g<]'' 57]eb~eR!x3k4CMOe-Ht9`gߌ/߅7좎MË lzg+{ m߃| GZo x/IXM[I#B!M}$+6ؾ_k+A:c:(IxGO8<'JYnjRۏ jmZQ>B׭-Z:6xU-MuRm4/NkV8גtNڦh7^Gain.摶*y$W1!~Mx ]_⦷fUԙV/G'llI Fvsߩ?ug^WPOh}1?#w̓ŒP{98n߳ODaӼg"Un $ox; +ִ A xWGI5kׅ,OV/wu,yYל-Zݚ~O_"'-=J ZM-)Ҽ{~.xƵe<68?w:t8r%e{O0䢪U9%Inw5܇ṡĚɋA b;ujw'UxĚ\h~#/9.?+:\_^o%~cדz5þf3J?HVKk_~5/_J=zF?Fc&(Š(((((((((((((((((((((((((((((((((((((((((((((((ԧf֕|f5$|:e>O2{(0(((((((((N{oO(W?!޿&`o:OY?_k4 zCQcqHR{ORΝQ_PQEQEQEQ뢊./gW^s1 A5[_oBv5ϣ S}g|[0yC>>hY`Gš?__lMR;0:S X#p% I58% *IfE>&cG\FeoJnʾ3iV9Qwi/D9?~o +N{ 5NCa_=/ s陟߶[dҎ_&?Y4WWNN_`qՏo%hEWrQEQEQEQEϋ~(H4Gv]&oD~QgR5:>ϦjAsؤx2FaxՒNUQ?FON4 MKw/4YLKYhx< eE~~Nt߀> O*h9t_(I ۤQ+~13zQ EC>v%HJ/q+۪?!hY?((~QE]|Q|wQdХG;{0B2G{=_*o>L-֙MJG/ 5ժexnO?c?^3N_u)t \zDnⵒ",y5U7UW>DWNBy22|Tb9$#O/͵$mє}~euƱvP|/ ̲RC= elWC9ob=͚xq2kJ<5)?~+eh(`}G;/Fc,OK?}}mG7If 4ο[N?8S % 5P-+ ( ( ( B3M;;־+jZ\>!,J [ˑ{eWS5 oQ!Fy1 wʦgg, 7nPk*1տ ;cbߥ~pI?C|҆?XuT/B:&+40r %]RsΜ6~ނp 道o_ό? TsӢvPF?ʲnuaN4bm晖(˫湌(QN]'# 7Ac>0MKRg ;lmY ;`{^w~Ւ#W῁/>"xɍ',[i3v),PXxw,GӕU-_|oI񗈼s[.R_bluy&QxXOׅ :|*UGIվU%ztل]O _'N |^j4hX6F8ӏ*t乴Myfi$yig2M3y$M4 _甥)>gJET(((z"(gVr]?ÿO=/&3mQz --q~|zM|EBfMJ[Zʖ7dA,[c_s0T5 =,]]{KVM>GMgɯQp8M:kkRReIk#IJcX5Zq(YyKɿ2^?SK4=SRu[i,="m7P< 9ASTk(x X@F.[fYJ뱯%q 8+,5YA?~_3x\%FZ8Q_&۲(Ia[6WW&3- U?>VMUtɯLK_,~esL=R/SS*x>R1QEQEQEQE)+6\_^o%~cדz5þfsJ?HV[*߃MKh_҇O~up?ѫLM[R*Q_Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@i[Oͭ+)3[Pk ?It|$|:ed5[QHaEPEPEPEPEPEPEPEPEP7'q_P5CMӅ~MtS}~Bia 7N?+O ܟU?:((((<A.i7:׈uoccn,8|#`WF )0tͨ1MRn$m#C +5 pNR\މ%oc ;o{$- . }PN|Eg<_LP~ A8wèf_xnlK2^I?~[Y(4_Q}6O" ,4d*ڊX5ōwƅeB7%9k->aa`I_줫5'4VdemvЃ^ q7!R=,2 p33iʜee%i/4Vi_B[xK{h.n6w [̾$Un}+{ <]x#ƚlf\4L '˹~ :r5~F 3j݄+sz,5hmC%QVF[FO?>,c]P#ti!4sʷ7 Ꮵ xӁ1pmB޶~kJ2R2..2_7b;U^|ќV{FqlBJQ+;'ci8KѼA|L93>XaŚ(=ԺD:~Gn# ~ _|U_<ZT*J+S~!x Fje֜g۱Sbuў$_>Z((( o4.ZMz˿aCqґ+ڧ_V/go%&?6,G?/ğWo\_ ׺#a_T(#|((((E (ZZ\LU@I W/%%[~$YwR+ҬnK?`_G=Sx[/57sw0Sbjv3'#V/x?E.ǘ.n^s3_Epg4q sϺ~IGΤi2Ss;NjruTHNOveNU%(b q3xCá[0J-.{2m7u+@I,YfcIcܓikxŜELW*wQ_݊cYxÙdmCN4ʵ.mzow>-x3 HmtQ`m?~,t'fe"4Ӄ=xǭp7$p]>LE Ƥ$JRۚe,-e9>|=xJќ\dW~?4|.׼){$7Z;KznaY!(T j 7|m  4l[Vv~u[? ]26Lwn{=OVX #WSOCÞ8mo{4y0>n3CݫU'!aY-Z9r/R?fx Uͼj?gVrt[:\В~_QH?-xQE9&w?_c_[Q+Y&3 $o_>/_|(i qKj[EW!QEQEQEI x7OU[4x ăU Wv]lu-*Q")JZ$ɏ಼\1t)sc?O?'{-X|-NfV(zpB_#:φI>yfEm}F>Emsu Bq^0#RM' :r/Lվ0|F?-czO_cڧo;Oq8o||"U"LZS<֣u9i5Q>ώٗ^ͬ (9/^S^Ke(9%øtgX)ISU\9s8GWO19nG3l÷)wa ~ULYTqOJ{ݧU9?PTLŠ*iu?4__FWm>in[q7AnvѤ;~4Ҿ|]'io~kᨭ|5g!,?r|_ tzt:(QޞRp.(6VSuy\cQE~6~QEQEQEQE>2|MDڻ|8v_(F{n+)_15TWv]9F2U^tk'Fҍm?-<~_pf!Z +;IfZnzw~.eeNdm)^mdPpQFc9.Yk^uө')J%yJ$`2U+ 4#~XSawwh$oMϩb:Om~~?k?K _أN'o?y_?N>%K_,g?|{ʇ`:-5z)fu\(, (Š(p(\+ U!?RWa&\':~zJƿu޵Cߤ_sԊE*߃MKh~Uj_F *?{􌾍_f2oJP((((((((((((((((((((((((((((((((((((((((((((((((+JJ~?mi[Oڇc_(IOSY'+'(C ( ( ( ( ( ( ( ( (>>׾{<=rvS{=&ѯo@V5A?A_7'q_~%Kx}?lwsojג+M*מYWі2|-jؘTjp7u>نcxfyNTpӧI^'MW._{zi‡D7G(H!3q?jQ lտ ?uL:S'g(H!3q‡D7_ً[ ۏ1٫;qL?:DOȟ8"Q /L~?f/5o'n?xgCfQO/)T?0u?G"~/_,p>B|58bQ%ĽSZn]]V;$7nUe2<y1GL\4J8ۙRS2C4GGTʰnJZxiҌ)w^uTw[ xZ?4e0r1b+m/tlkT?M*K؊*h{Zk3O%㨙GڷGVf>̣<_3 ;x=1K4!a_s+S7pU3[ѳm#ھSh^0kBEs*w΋k~5Bx xURJT#^WTI/)?Lv~$Ѱq|y+_4 Jx_ΒzGm wui N|g?쌚U 6@}ͻyXK}!n?د|͞/h>2mOIc|ޙo#q˶EJ϶-Êqǂ?y}v~ױ]?Ņe#GÿM¿U淶<ʹFڮ46AR=AȯWOռ Mi4C>1."ᵸ֠*P[o[7v~> SWY-q$rkiG Y<]7aQ{6R.T^gp('sTZJtߴ_BR~G:Q__~+| Kk44,XDo?OLזz}q__ȜMœE٤n&ٚ4_(q}ܮ AK⌻IKZMzŭ o4.+.JGveޗk;m_Bm.mwScЀ?K߁_wf j*ėZw5FfW(ɂHlH{U5h~Ӌ,ʿUTCٯGǮ-+eQ+%:U!?dKz>pIG4p:~Issm.۟뿁5Dw;45 NX??M_sE?!w҃*OP~îfu"/6;Ec\04i~ӿV5GE?]ʟS_뿁5Dw;45 NX??M_scDmO??}(?貧T:w ?ioh]' -~bi~ӿV5G6;Ec\04X,S.J,U?AuC_O[ >~W k:x=h-R6FfeUE9}kᴿi+?ō&BMCĺU6ַqƉʥUPCҾ[|G?8 bpqbh8?cogf^|Owۘ+G Y6' 1S>_R4o;]Gv%s,9/39rR^W»C>kZ|O*_XQn7M[| Isͼ/{ :GMzǖm,S\nQ|]sNI.2~+N;Uݝyy6Yuܖ.ɭfrث+ (WZ]Ὴp }^ GC(hn=Y=+ ?(^S[c _(_ǟkHf=b@2Ğ͚~{]1n6HNV ǯPpLTܹ3ڬ[x{M%^}#`:ƸpVO̟Geҭ4&fx3ߖ=*zF|9.w6qHY4^pˏ6B+K_gVn/ÏxG\5麶`W-L9e^5%m\)ޗ7_<$Rs P'}9?v?⪥n>P?jzq\x\sn/q$t|kS]е j׺Zӥ0隍Z7J{p{VPkx̬J`XБSZ?𷧴m?|}NOl;_67I\++~7[EK=ÿj@wV\I:^y\Ùz 6qQEQEQEQEQEQEQE/Q'I·m~׏;xSUjictY]w}T|$o+޼$]\]Eik\Le9},.M_f:Fj'JVH JR-k~'2Vqo X,CZ=8ԍNRUfznI̸QƟ [2(oxIWUx_I V}e>%/uj?ObٗGſ/߶n.w ~$G%.ğ:xSFPo?G_eQG1oDÿƿK]C_?uqQ wk'??f<)(ķE#G [2(oeQ_%.ğ:5WU3ѿ??[OWD-xw [2(oO\T]I* -'}Q!طf 9׼Lzgo ɪKgZXR}= ؈6O5]I*XƱjzNF}%-&v'Ѽ$/dG^49iNܸxKII-ϼSK8OqzJ5*WtmKXdUoѯ ?Կ~@W҇O~up?#j1zVԊEWEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPEPZVSfkJJ~?>3BO2'??ΙY=VERQEQEQEQEQEQEQEQEQEG 'I?7W'+Ƈ48[ 'I?7W'+MƟo_>,q3Qi¾4OpUSӢ+ ( ( Mz?QZ([Y,f[+&Lz2E~_<i> ]:XCj/g! 1henTGp8iVV#}uO;T-sFojGiEug\e5Ǚ=L0ѩNI˞N42~hBeBE&Z zvcH?jzk%_˦j6&m慚9b~. Ҹ{SmHeEc<0^X땷9fRI(M7&s%co&0"Et\Q@Q@Q@Q@(WaR~,F: M)5<m_N]MGۦ<cÍip_Sm=/5og-ļo|֌}<7T7-NeT=Ŭ-n$7F̍C_%([#%(GQE^hc!Pzy|_^Ex[zχamiZn??)MgXO}HMb5Ep&rC@ +^;Ď5,dq/Tg9TxK,|_xyuuyjG5#i/S|d}#ÚEl 2G MOO"Zٵso#G67EyG;SKA缗ψk^y6q3lPxWIQHҿ}~+O^a7PyghZ͞%X#9/ҧMLn4/2N?b4oQw뻄d40xTq\J_n,}dSO3#?h޳lӯ/4EŅԖs!vFV|3#?h޿, %O3NzITɑהgqY| }+6}|IY^/go%&?6 ׺#`PE"oQ@Q@Q@Q@Q@ c}9 d;>mўľ%¯OxþOs"Aq䞊/+}wxZl$eNe7թJ=/0[q!`p>䷞'(ԫJԩjJsk =/9w~S/<5H5;ARTy1"qŸ,x5N1J0э|_p2JƺINr~ˡ­D?K^?VOs%?A[/?e(_'u.a|^ ?I­D?K^?VOs%?A[/?e(_'tĸx=E& #ϟ*ωN|s`[OO֚^Yx?EcZ×X]+yuP &虏Ec5k ,E=ZnW5#:E#!^pWว)#4ZI|Qg_l+1o f8r|ſk?%iG#o:BxB >YE=E30ʲ:0ᕽ⿬/< o⯇A.-ݼoHS?n:kZ o 7<:ce ΧM_q]=:⿥ثiO٫t4[Hi3GO__KƟ'Iֺ͌vI|_>,xzלU~K\i|s*Qb)ᒕ&2&Zym:jYvW+a9>k >i'iU~Xtֻ2+t>7nS:'E֕Xy·#oEO/s8JT#J_ EWEPEPEPEPZNki|̖ZnnwL8dU㲚??&߁7|Pc \_=ȷW萮z団__<+[-ZRqhRJ0+u4GqxTJSQnRo4c>;|Puk_VJRԴ+K+Uf Ip,_0{}6xKi &ᾀ?ҿ}>c%(NrcM-Y3ko>(0q^1(וӔoأN'o?y__O+W(Ia[6WW&3- >6q3ǿHOL5RK_PQEQEQEQEWBMФrUOzяO^MWL?Həν(E"[ok_~5/_J=zF?F37oHQE~~QEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEQEo?k6ԧmC1$Y')镓lQE!Q@Q@Q@Q@Q@Q@Q@Q@Q@d~tS}~Bia 7N7|>}OM _48[ς_ZG?'rTt袊?((((/%^$֚qUm|8GZશ|uglSO{`QQgк,n3 _W/37wQ5|伥/SG$qoC2F^SQQGQE|I!EPEPEPq-^Bf,*pleg!kO#__^@1~.m_ɂ9{H㑏EҮ D6:V%PF^F /IB *aܰR{sB5%?2QQp[G\By8圩F+z3To ߊ {ڷ*xgF ѦuX|Gxujq$5WMzW⊘Þ!>W QW$(2PI'i&~(MWk7Cj_$"JMf_q_m_Mu:GψʩQ_'QEQEQEQER.,|S?i(s-Z;IW" ۧc˰8G-AεYFME%ˎl>J4)Oh+O3ũM[Ư4Htw_id^yןN>2 |.&+``1_CcCxcX8~f=wƿu?|YVyZV-XG5; ߂gLF՜wqVyJw2)xNgm p(e&(GNoZ( ( ( (CȾ .U,+}b }1(~?CZҭNJJؙ{ULjV0[=6xsZOW!uw *|ti!Ecd'5co;9yqz5˪}Q8!ɰY.l>"jAvq_5]K?}}mG7If?_|QdKko*?K5qOu*v[ƟY/h骇mQ_8QEQEQER)i= }?iK&"U+SKuލp qucI?ƾ[ͿaW?SY>4xNn_:RxK^zH~Z< N?uBT+ط#w_Kk϶ᇓ3{G&+2Iv09V ;8ęsl5Hԏ++_? G8s2W*rV^qvGI${~ "3ixzm[,N;1 PﴍBI-4Bd-гG"0*kh{_ |;^xֱZRgPmPzp{2WȿPr㿀ƚevuSRTÏLzOG`X\Ǝ )~1^wt|њV?>W^3KHk$AFP̢-E u-z((((΍G`-_П ]ZѭI*|Kxogq9]~"jr/G]꒯!cnBvKg1K A^/a&u 4}Nl_j!WMSP5MKYnk5Bf%;I#%(xؾ:ÊKQGa8۰QN?+8zj._?K}K|$o+_^Y~*t ?+y&ץA_GF2C!x))tJZA})k ( ( ( ( rUOz__J ^]7B|1ɽj隇I39ץH]?Կ~@W[okC':H&c&(Š(((((((((((((((((((((((((((((((((((((((((((((((ԧf֕|f5$|:e>O2{(0(((((((((N{oO(W?!޿&`o:OY?_k4 zCQcqHR{ORΝQ_PQEQEQEQE ?V} MНܯנUK&[3c-#^=5ڧ|ؐVw&?z$ao+ln~޿ei} 5=eIrt]^#~9~&m=Oo4CadcO9?H.Ï8Ya?f~~loWJ:Mwe汫^%gep?|݁ƽ? _ԿL|9k\I\\<ԣo2xvlϊxo+pol>"2QeiEH~<| P~$9u? kf}2WuL8*A+k'|/> 6Xoq Z,tta#85~' ~/]xJcշ >;A^(ah 'I/l.ySr?1_W¼<[ajRӺkdE5gi.n'/UN1N~34Y- K_1-֣U񾎻JuAPg:O? '&y-UDLoĊ " q2y]ZQ_oʛ H?WĮLfPωO[?7󞝅~~Oo2Y/xЋK-xgI,']OF~28?x.p2b+EšW*~mn~=Ǿ:x{8Z|Z^ 2U*9vMwsk=?y~bwt,5b<^sm3^ȧpU3^}oawPzP>n/S*zt׵|zϾw\V2jw1vkkſ|J^,qgќeN/៳֕w^I)]o)r1[~4i]oX-cF{eƒ)ߘjZxI?E|$ڿ=ÿZE$7> tH2*//,>xԆ?s\ï,ԫN7$%+]ҵS3=̷ 1SRJs5s]_LG(Jkf"TS?~O𝧗mCAT#Fe}YON}êt::qӵY់5h-Sž=vtđAde# |adۡs"2a&N_KG8ZX\tc #+kWg N2j;|K_K?}}mG7If??|N}}oG7IfCLU#xS % 5P-+ ( ( ( (ze [WS,/_ q߅oΟUw?JIV_>Ylu0oZTҟ? u5 fxyCWE%8R?2˯ i픿l ){*ZgY )׎txJèibјMVݿ[̽=z |iִg[}-֗#$hFkta_˕zO¯^91OxVMb_Na(nbzg< ^a,3חiޞҝ(5٤dt:mkY,/ iIf`.)fofԖ> ~>>ak/|LzmivvпǏh} ~cJzM=f#NuZ>#xSO_ xƷi[ۨ-ZTi #^N]{uk_߁'GE_xQF)D7' yӓ4pFW`g8xWHE?f~Qt㷴k.j.~d,73|;`̞=b_ Xako޿H(?zM.P 8kS7lt9ibrmNh5RG 63xe[6m=K~ Agf}\?'Jd"X`h4'5yui8MkYAծ~_]AoxZ7 |J{UXtGj x/i$ [?吝#nñ|فX.^55bA7fJ+zW2j+.|j74WF/&_D3.V]i/D>_Tt}88Uі XxNS_ }<,p֏\D?yH5jZ5C^o}Σ̟ܵ#8Z(KI;IM F,=(СqVQIlZ$Eew R\pG RHV8LQBZ5ZsAT*oBfb㷎7LJ#*j<;`Xvzu}2RTV;O}|.kOi(~6kNG<;`XvzuO.-IIÿf5'g0٬;=:Q`]OZ'F3'Q?l?𝞏xwCfGNw u?hğ[AOG<;`Xvz?߳ E9)6oc?m?REكc />,cEf~(IOS$,y}%vnO153IoR\4}P {Ix|1o? 5Jľ' \M.&6rqq fWz? yo |3ѡJ>uVKsbub]OxyeIU tip\t4&h @1-W?n ( ( ( ( Cߵ-ӳ7O |Xom-]uoc&t[tE/˞ckn8K 5ۛ鑶\XhY|$<lQ~͎Nj3? cңWN1'(ES4-.{^+^<:%+RԔ8Fq2u#Rn~?y[Cw'|Y|YPtkM[mf]j؛|ro|=/u=[MZ0]irXy#,',{8y>ɕO <74e=FN+y\17R(r2E^<[IKG#?S ( ( ( (>><~)k>/z&Z@R[czW/?|yQ/MYX`f$܌#4~x ӣS-i9YI)$%~U?|IR<ʇT%Matmw7̿! "|w澠>9~? pΛ~ϫ5s,(0xi9 LpEc#gwH ep+3U"O |@~/j&A͌0o@n|x޿x FЁ5LδkZ/umZһNz[HFTؙP^ArDrnj/a;bMo'⿝]mI$i&9 y6Σ^*pߗ}xbxUuM?V'~\Q7:WÍ*0hRz3}kXֵW::o5+1:Qҿ>2W0]2vN6~H.Srt")%yU%y+v (((ݿfoxs_9mԶ>6u$K%+'/"+RGzu[tmgffKd`d<X_tǭ~2q?pVeU:2}s״Rji/v:^/^|[ qqT/g%M:hIzNӶ3cQH((('GA|2{֘!=3|c 9;zcrσ&,π8 y8<-qWtڌjQZtz ;o:ި<O2{(0(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((+)3Yo?kj'??ΙOdL`) (((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((+JJ~?mi[Oڇc_(IOSY'+'(C ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ҷR5ZVSf ?Itj (Š(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((ԧf֕|f5$|:e>O2{(0(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((+)3Yo?kj'??ΙOdL`) (((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((+JJ~?mi[Oڇc_(IOSY'+'(C ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ҷR5ZVSf ?Itj (Š(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((ԧf֕|f5$|:e>O2{(0(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((+)3Yo?kj'??ΙOdL`) (((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((+JJ~?mi[Oڇc_(IOSY'+'(C ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ҷR5ZVSf ?Itj (Š(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((ԧf֕|f5$|:e>O2{(0(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((+)3Yo?kj'??ΙOdL`) (((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((+JJ~?mi[Oڇc_(IOSY'+'(C ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ҷR5ZVSf ?Itj (Š(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((ԧf֕|f5$|:e>O2{(0(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((+)3Yo?kj'??ΙOdL`) (((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((+JJ~?mi[Oڇc_(IOSY'+'(C ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ҷR5ZVSf ?Itj (Š(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((ԧf֕|f5$|:e>O2{(0(((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((+)3Yo?kj'??ΙOdL`) (((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((((+JJ~?mi[Oڇc_(IOSY'+'(C ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ҷR5ZVSf eI'#c֙E=c=<\K9ĬO{Vc1L__*%K<أ͈?WD2xM5+cΜ}&ajU?{RIԛ.?E=#l_? p3@1y.%N ?ՉtĪ3|.?GXYbGo5ƥkf9/o|%.?sE=c'>_;M8>Ӷ?Wy' <v=o'&MЛ.?=t_?Wg&_VK{:/| &Sqݏ6/("cϜ/%#u9sF.eqr0 ~ĩ/| %]Kb6?+B[qpW?O{܃֑'sm|/Ït_?QE=#~5ā8&oZyIp _J_O g?K|أ͋zG}~>073 ]L"{s=֩}ZͿp?:/(bi>|ai`7k9op?O:/(Nv\M7|S}3%ˏAt_?QE=#>drn'|:_:a'yIZQLأ΋z}}A5'pzM?l֧%;kԗ.?XG$7Lg 4/-k.t_?Q=#~y׿FJ&iFgciĩE5odq΋z}<ؿدInxƨ$ 3PWZe%B_?E=#֏:/+/)<>;=Ɓ泏OCC(%3e{bp??6/(bgtD %h_Eo˿p?:/(bbSYHl?֚'3%ˏB>t_?Q=#>KwqjA>ll:)>_wB_/E=#t_?W8n~ֲY?qj2/gkO7%Iأ΋z}jA$qZȹYmܞ8Iqj*7ZOO=4|?/A_9ݙ3|:ȕnK֑#EAe/KDsgχ{EA΋?kX;''|p "{կk?{տ-h{EY!g̟Y?.d֩}_3L.~o=K?_k9Gr|H?R.8!=Mb_Uİ.~o=4j?'G<ԟUU"\u7RM}aEZ[%2sM3ÏGڭ_#[$xfȸ㰺iĠCkC_ei>o=_ Kp7G7rc֬?h b'DJҶO|.~/_.n0?}s~$kr`?h82a/4b_7ҞS#˟?>t^>ZMCַmc&ks?5_6_J)=?χ{E΋z}^-c&k2sEm.f?Yj_?_4_IЏ.|أ΋z}o =>~\`*9j:>_4_I?p?A,GZG}<2?|85A 9|vݵc%vQ_>_5ZOdqޯ:/(1_P>?LF35m83I- _I6Kc}QǟӟWB61[2C+q\LB)|$K@Tu+E-:a}r޸wûpxLCfmU)6x4~Ʌy~{WtזU_aT28:n*Oվԗc>=*ƾ kqP7i<}}i_Ź(c%l;`\|Y޲ٵyX,kU3B^w~O铚J2LW?$ISټw/]?_gZ2E!r_izIc9׌Wf&UjQ5;3_M Uq}}Y/RO}z^}H~FikKelCI'{KOY)(v+^mOiq}H.^nOA_L{Idttr~*|6KO Oa'S< /?Vit  JzQKrٖ]Tt5w:287R /}?Vfz^GGGXiޗ#s="p0{|k\_0>9)rϪ-?XsK駞E+?;?x/ q _ON?_ZiYrڿ&ַ%xO,A$HݤmWo_j*?5xn\QQaֿ5_L t  ~+|5ickҟ@ Wޔ xARBv~k]Wvφ{TO$aǩ8cux85(ߗeN}^p7/s/ 䑺"xKf?%U\W򖿂CmgúĎ-&-0{G '&!| UBջיx[Ss~$a9Z=t&?9oy 5.+?/N:k/9U'ۛ^z:/5,w^ LE||~\h6w` &$co׭~SVp*Rַ*WAÄngxGj!/&?6*#J#Eys?il5C}Ss o=Z7+0,ǩR k.q$uAK.$Ty nn_iί ag<}F]o2u޾(eUv dxNVf70խ]BJVǏ<00ӷB\1ʞiqj˕*8:kõع}4jxiᗷՏ%/%~)|8OI-x(ܫA>e?o?5YTIr=ׯO Zq"~) כK3+WFZ1Qӿ?+ϊ_ P ~3m=0|`I6|_$8ud"W 2>$W~Ga/*F֡TYr!f>:Vi?M{/c_MGo (ǿޯ䋥PF|t09uUJ Tij}33m)d4ugk'y^?=y]·YX>>x5M_ɈJ %:vr7b;yc{ʻ7m_a^edqV]/M`' :`ҷS^wGzzl MLm+u[ID>d7zT3޸BUe9VKݶҩK-[l%}-._;|>A-?-f$Ti 7tudc_~=#vssˆ?ʺo |J}R-$Rʱ~,ʿwf{`>b+F'1Pv);s'C4r:kI^1M{lR/X?qo//XMd.uNe]e,XҼ/UsT2]ɗ;<^GKO}?@Bc.'®9&?m-GX㉞VmZ&WxG⛿]2iVHw0cc+ͩ&Ql?`G雟OiR4߈ C:uKdH>Jo骅]v2=+>I<)1=#J)_RF{U9\]_Za+կVVImt1wnf #ud*4w郝q:<]Z3ɏ ")O^1d'/mC$M>-L3_?|?[/Ck|nnZ)oHmGsd![`y]͜Ƴ#*uTjJ0L.5Rw}OMYKƯg(WzX:dr iڕ 2Z\5hQ-R*[oދ`$U_}Ylͤ%ʿt^p_M\_F\;M*RԽm>4( ^InorXOݲ[gǮGkz?ڼ=ki?c2cQkμOtgFu y !Pq^ف_ͦU/jK|EwS%W۶,DĪȬN_ʡ Lvс:Ǐ׻ݧ5zO-m//#h+BBcMnlI'va>=yJ5Ƿba&+ʖ]O[i .u"ݮM>z^B^'״[$ϗ5ont0Rkοe75]M̱M#ay%*֩{~Zɢ̫K?IĞ>VIejⳮ{{e,8{C?NC4kI8ov$}p -ɨ N+O[Iipʶ/wl8%&qSOsk(3lVM|/?`o_ DɊ_^*_8LW`ǚwОY.u(?*RFs_#,E'CXeR~pe+ 5\dx|V#XJʾCI??@B_^)É/, _<8)T_ʻHr/?NyB_:B^*ÇE cUG=o*?/GCA[CNyB_:B^*ÇE cUGq_GD1_K$", 4tY+¶cQG$]~7nޖr?G R>kzK[ |&TU} Z4U2sEoeS#O>(3__ɻt;;7]ĂZyb6r&kZmgI)n5M:ϑ$zbpq_Η4mgM;AuO'bsn׉|}/xoFu`o rG}Pq$p2pV)崽OPI{)]3-gIL9@>=WMPT$a T^hnZc;N*߄mR9cɒIJ61_]Φտ~o>_#SG)>:}f8nP7}ۑ5G,._WqZE&0 O Tī|'cC&O,;$nhRq6޿1eF$ ۏQx+YIޭz|l fs+q&8{$?{=8ZF 5U:Y߭f˹n6Sv[;"N>H?ʦ }|m?j+xͣBmͷ}k<tɬVA5 ܞy5%OZZӨHR fG]=c9/-y,d 1`~5A/Mx7yW6Pk^[^ Ԣ멌r_ڛwYY0=9.?/V@zr?N]½jټNwoDyqSttW4f7v %XhbcYsJ^Mgokm#BD{pܚc[D.V݉hϙ:Aާk1MK1-?~`žQOqFh)H<UΣ`!Ny3\|ϸC,w vy5w%zH9wT> ݼK[[p_?++>[wIQ VEFڅwl 2<ʺ.K {91[D6Ȩ Ư%-RpqQY1Kf*2̿_#4ڦ5k Q-UW\e"Mca#dM|kK>iC V~] *z*&6{<7Npg'㡄TQ!_;ӧ&jjQWִg_άxšeļ _ '[X>" {mktnYM}#^86KVUby0^{?¨&v)-*+$l_edfR1]}~1W}S 1M[KwŨʘ;Hn#=䰿炬oPY^3tM(a\z>&yk7c>tkMHKEV2-p⿜.Ş5񷌯#}KcWY]eZ[`~Ծ|]z4sʎ;{6m.{&4Qji7?ogcpOX~N_oWéˏB2#Ś{|s_xw^ֱ}L[WHDk+S0GJE1U`v+|K-4ʜ1BhsOO&kǾMOgv>%VJ -ŕ?跚ݴO_̷ x :MO3E?-ռq*Io!fa͸1^Cg6u~v>[Y,|+"<)]M[GCu^JʞKI__c57kzDw6qjpk>:6DZCh),Ɨpx5fHsy Ͻ) ~> ujZgɳ-d*>~%׌|WeH[(-ʑȪ0C1^|>xIN۩hqW CNiK'M{?AO"+V(ue ${}׍eq%狼/iu s[]xF؊OhGqj ໵.-庒k<؛vz_8=|j/c&_pr!3&zk8p&ELGGcϜc-}u$Rϫg/|EGO?O\ :MKEGoʏQG?Ir/Vg!_*?>Quǫ@TyQq*$g!_*?>Quǫ@TyQq*?Ir/VІ+?\ :MKEGoʏQG%ȿ}[CNwB_>p|% m7Q /_[iz*?/G$"oX:iï-=G.T~m<T_ʏ\տD?`g!_*?>Quǫ@TyQq*?Ir/VІ+?\ :MKEGoʏQG%ȿ}[CNwB_>p|% m7Q /_[iz*?/G$"oX:iï-=G.T~m<T_ʏ\տD?`g!_*?>Quǫ@TyQq*?Ir/VІ+?\ :MKEGoʏQG%ȿ}[CNwB_>p|% m7Q /_[iz*?/G$"oX:iï-=G.T~m<T_ʏ\տD?`g!_*?>Quǫ@TyQq*?Ir/VІ+?\ :MKEGoʏQG%ȿ}[CNwB_>p|% m7Q /_[iz*?/G$"oX:iï-=G.T~m<T_ʏ\տD?`g!_*?>Quǫ@TyQq*?Ir/VІ+?\ :MKEGoʏQG%ȿ}[CNwB_>p|% m7Q /_[iz*?/G$"oX:iï-=Z>GX9MQq*4a6f%'T>}WC/wUr`_& ǧ?z+7l>m#5Nz5T4n^jǯbs=1ۜ5;'gU1XK#1=p:ը<`zPco{"n6.1{$n]i JY['i95]:b9=+H-.-#ڛ3I&xL8xJCini5^Iy?7~Mf?#PIu=y ܌4vYT{U6vr:zV|>LswNGҕVǿZ[@qYzx2$vdؽ)b?1l<zcJgZ{I ~ ϿzYOPfm=fSE=NH+,ڣY03-#+>sd|ǧ& z~u1S$0=%\X9ՄH'=+]13ǡ6hW0EM=b܊lIQ$E?L{nI<ҩ}*Mݺ{֨А{tC9ȩzZNy ȡt}.@Scیz[BzѲܮdg{JUXDq͠nB i#wd0=(EW`vSc>8펵uT93)05ЗbC6ΧqXr@FHk,$u䞙0x3Z)-S!,gM㿵t[a9ϒїsp{ 9XsZ+WrmCBxT A+hsNV8)-~eZr?7=z-yԝ,qr[JON=s{]٩'ݞsUWۭ_:8P? Ϛ'GC]YnR>ⓩԞKyԖc NseKnw' ůATitӦ1U=xC[[D-@U42qFlp}?5-I?ws҆`Ϩ5{Ӎcۀp0qzԂ$D1?[uP3XICmm1?ݨe ҷ W4hKkmdsk-` 5Z x{8޲xAXs}1] sZm*@? kUgs}K7kK}+.CoWX|ou_M;]ńo e%(66jƋ#/F̂@Ülz6s-dc$taz|\k[B4#)PJ+_Ƈ?DT'?2Y \Jfvj~~cҫ^ƷZE9`F5O#mAHŴ3܄Fq9ǡ l FbI3uxi\p&Osch|o kI I#+LZ0$*H?ӊ_ n4bm^"(U }3ھaKd wq[RGec澻4ᬣl.3JҌgGGJ)w*JhޚJ\V<}^Um*KfkzK:d \n1km;Hr2dLa S3ruthQʰ؊ܜ#y osτ:l2U]_'|HΓi3_ggv꡶x< $'c3+ rr1揼ӭm1Z9zJ*ۦ!>jVIe$/nH } K5Ym- Q6a {שA4 3l.F.7 prmq>q,>[*mS}O2;m@ı4p`clpjf* ͣfEVBQڼĠ/nSj񖇷G bN+j`X\Yxt*kOKf9 *f/*mbFV2 G^OFi͈`WQq]dyU(UqkonE^zk w0hQq9MKH?jBϞYZ:Jo@pm5ylg|ԩRqu=ߡ8Ƥ3.[]>z{1N_ ui>Xa=;[' _TI#6N"~]W lot"gHdw)nkxOx7&sql)Y0+, \1n. ^tj[3v};CĽߙO5(gvIp쯱|;]ϦCu`ǰ ~xK|7ҵ6$͹Kk.0wf_⩮hhhپZo $0:qݏz߃P2 Ao4_0iQeR.ࠐCwίq i@6$c~a&mƵYYRVkRJU%YrN xI ]lw$k>S713cOjt;>熎=OXyym:!"[XB7.SK:pT׿ji+xD`tMѲ>#UhW/+‘+7sOS8+VIM->ap|Mom£jdU$g;V3m5)_Lք1aji{=k4ci? oԐ+A738^. uSY Ai!|yMfŷ6>0^?-;x_3xgߎG;jxS^'Oi^)X6ϕ8g+Wҿ /\¿ 9}6յH$-mb! d1T<<#?6ִ_~U}%rW+I||i~)x >/.h])n2k"obU8Nm<^/?Kf=d^ GƆ6w#FRK{y~>?v7..I\kpڅ1+I3I$OWg>ynKx|Ijfnh0B9{6<]x<=ge( ͵N[iֽ~/2:Scx|FYe:[薒wN#G ω4ZMlI?34~W} BrҾ:nyhBB޾燄rZ[Zo-wyj+*ut/EaZvJy~IۗKo^}l|zEm/c2gh]Ez*w>\WT|9 ~2x@#`pvfTb >:Ӥ_-e .՗+yi*p1[Wo#T𽎓}J-.e$K.FO<ϋrySo>Ùo:ے@'8#8thk OԧHr1?t-sp޾2IӋsbu`=i16p1uB9ƾa;0\ݰD82coP{ ?f w> ʤn-33KwKAi=I]bD2O}1ҿB+8>qm$M.wQ:l1bkOH-f"di R3'ֿK}+k6@WZ2VL`WfU5]|2F%ïcoE Eudd9n}CNyW* 66PpŀuWkwyL VTU]57NS-p5 ּ\#Fe{> u?w ~f#ZZKy*-56mBW󢉊4{d/gze;#!F7<< ie|68qn+ʢ+EBQ[ikqkb.3 R ]dR)W`?.湾6q A"]T?zO,$# ew=k5k'wJxnyGfw]jw3.o OlkѾ)uwZY-lͻs^;JۢSd6c.|wu-mi"HѷrIңj|JEyTn_C]Qs% bRλ״wz~F$\w\vHt7wC' SB:q]|wvk漄74( Ɋbj񍢷k.d3%ٔX, qz_ EKqD `2 ?x=?{5A,pϨ=gޑ_|jzr#V\s\8IF9F*Gh}Ǒ 4q1J2to$3R,2 !u }H1=/伸Ֆ qJ[yt{t Sמ$/,K_+fm#nͥἺ@v~^c’ZϖL<*Xye+qܚW L %wgz4KMJFyC# =ux\ Y1,~uZ=5ilJ#}^^l(bI(Vn?|)~q%צI##I-׿YrXiRH`3 +մ6mnL6o#J70޾W&&l$}/-e;h:#Vi;4~ y?ix{ج@#vzW':hDbȥWdЩqO'.-[XGCҬʃG/ùt4ze.2iug\WWBT2Z<ܙr0U֦S,//k7/ٴ{2=m: -* (!P]7K" k,6i4ݎ99CeoI"I͍\A"ʸ߃ҽៀ#gt\w.tZ}cU[r? )ӥ[=|SA]O\Aۘ>fmGZm{W?sw7C,2,031UxK/Zx_=OB|bD&C@Ϳk 2s ߉gfT M7T̍wwy>s~<.)Pꪕ''W*oX^}?k?_3S/RK>oAuev}K{xDYee 2~}I+ ;_<%𖧧xdX-3Z92#k;ߋf6IoX教nHh~0c q,3^]ج 2@___'N RWuǑSG*^Hu? iއhl⏉~&i~RO}5 dCrQ?f <3 .thnegˊg|nciu=? x>7o|LT…nȿiW N y_ğ ^kY펵kfw23&Τyj(,j>XÓk>7wm{ohyp6)>Q_3]cTŶlj-YZB\HAݸ+hx:.U/G>]xףJ_:EQj%Q8W^Nfeo|s_|=-Cѯ1Im@I "߅t>*|w?ϡxJf.m$ .꣬8wռWSKw{Tw:60GPzbiE{3MU/~noj6Dd%`OLֽwV׾kT.Y{+udd/ 08+5 biV]/PU%XhVy\5UеVzm~=[W:qyltEAqۖ=cHjԔR|7ip0j0__ø8Nzuƛnʗl%u/lMZ-jJMwo-umsp.<].!eѦͬ{cYڽroS\5Fۚ[+]%VլlV_%o/@_I0tH c'ş hD0Zi" kQ+^ˢtUR&8#Gont[Úeԉ[)Us1xU0Tgjrzi};]cSNTͿuy,Nv*^j/`h`soJ{I-m'W{K;hː OkpkFŢ81*ۻb5AA[[|Nc.ӌhWRFG~גrN{>c:RymxQ_B|QEQEQEQ@Z~@ Px⛂z J( ( ( ( ( ( ( ( ( ( ( ( ( ( ( 4qi_ Cj 픭q+ =A<?pڤJ5,HFVFH*{ ۑڐ\~`o:s\s9sPsZͩ}9gCt\^ v 'vr7VGN/A}:~͓tUvdQiu DZ5|؇P#:st6GZP xcמBnzߞQnA%jpa=㚅+h&ܵ5Zy$qQ42sX]G8z$ZEc)dm뚌Fw9#+7\sQ}sl֜skW7 #׽sl}x\NKc.vo>S3J'sr3&=>8qmN'?8bx|ds=V\y 5VШ˪59?Z zqd?1Mi:{ t4nG/uU9a.R=3V|8uQ]c~{~anlҹGSq$g'{Vr}er_jeo^#ڰr_J"k tf˖㞸J@^}+)5iI?754H*Ay]_h?ZCT`. 3S8j LqY\ 6W=IQFO\UpAbDHC`d{ac>1z㰫c,x#Ҳ䁈#'J@^Q:Nw8ܬ9fIj9$ulpr8SZq##kH]Ny)x?0F0}-S?\wSZ[JR} a nH95 #28DV6 =GaZ hIq]-tְw:b7-"$z-c裎z5tV}IF桻-Nk[no[ASU[Uh+v(Odsy9 %-p0qڶ`j)'$xT SN=J zFN)5ԺHݽ)==3Ҧ,AzjϜkV-YXA#!Lw5#]Bpm58dMʹ-&- V-'dTUq||E6vڻFQ!,_o#/I~N:/aPڤxM=W߱4t~=| z7"]RKky%HbVnğxNe 4N}û7HJ{zx31,3~q|Ir>7(~)esp֐O0%T㏻zD/chоTlsV]" rV9[JE۸z^#?ɒt;Bh4C;t .q}x 7$\+܌n(`f`(e]c/{F]8^>Ö~ڭ#aEMM9kl0*wg}#."-zL-hj_Zr]YҾt B4d\i.n:J~Z#|:g|E-+B#myx=Um)4&b_"۞Κz&Az6`h%i#[澛.K!8RrͶgD88R[];K#sYmkm)Hcy$Y=x ZZP[8S8^犿|":jQɸ6Z.ζ + ׊:&aJ>jqoO\7?MK_h李hWP@6d ێGÀkbwpD*a\W%%V~u:8[X)8Û޾3D*R3֬Aq2Y"||AVz\7V88+u(5S˱>ޥ]h36 .$AuPm_$muq ",QqZBtp⸦u06+y'ќ%=oҼRO֜):~]LJ'8g=昇b,:;yti{%IWMȮjÖCP۩`ܰKҺk^+-NUێգ,1 pOV:f~2)їڋ5qa ?t.qyWLջ&mPF.W9\.܁꾢Hx?z] #J-_OR{--2H|9GQھVе\J#ݹn?⍏_PHkߋ ).1VeQ (˶j)%>u/L׭!'BQUgVpq@1HV}!!"'W^ ?<7yo.s%Q~۫ 8K{J"x3>%ĘGht?0j>9},7;[1\Wk@\@"@[i~^Vvmprq+#j2[[ P6 t߭}>pتF"4M.f֟qY]:XjTۗV8ML#*J9dc ʸ^_"Vo5Y[_~+_çkuV |3ԆTO#xݣ?q+ _RUXA)| )]yw= ZЌtv۵Jj{iq2UFp[5_Vn^|b3|ZT: 3f|5opڽq*9jNmKyHޗމtIT(ў|"}}u*̲2WB¾>h:-rx'٤5J91!^޼^X_2'4s*ֿr83*S%JV4ݛΝuR0%qi_ZmlVhm@^2FokS⾫]=fPs36@n]>.Y-UdbdW2+(=_5a $`;2*ʱTf2tUZΚmw +vm,Uv/s]Ex]Cj ,!lZnkprO<~MS]҃ cnX/6:Wx?Ly,8p-"Nv[W927[^ON\vRw7_Ouh}GkciF=I,W "+H=+د|5iVd̚iicmml.2+NB<-Z+G5wiˋegץt> i|%juI*^6l0=Ɩ'[OoCiCXG$v̱ x8UfOAҶh.lu%}J[">pvٯ 1x|M(+Sg{ 匿~L$xcMĚ3hQ47Rc`vZOx&Ś5柩i tr*Q#$͏س; HcGгԴגGj_gtKhpMj\GaSKn?1ژ|n Qn4Ԓ.mXl]LIOi}:'~dk ›NiiX~fp_t]oK4;{H/q`򡗅U+wz_K]E;]JoNžo}O5Wm&HSƉ fQW8Rqg oKYum(Тwr:gҺޡ]vϴJYrܓLtMOG#Cm%dэ׌TKմ/2JOi8s+K}疭okCjz%34p q!_X/^i^?jRijՉbNmk/hzt/Vow,k)dFfY:׌zLt`5rMOlv nނWv8qY} [zoc型, Uvۘ63<" ` Q[Mu~mq/.,.51I) =+|[wXާꗐHR<|~d6 wۆ;]kqn>>SiJI|W/O|$rxCMLyõ<IlrE$2$,D~xᮭl`vJ*[oi͋gO)fڪ[nO8+eVkZy4ʌ-o𶧓 r3i:##v\Xs_Ly[\|,:澣oefdi c*|~Q6F4VcXסl* TgUt wG1YDm&^;{:@wu];0!rq~/x2Mi1i{FP۶LJ!ihӼ@l]2IJU<"o9oqf㧆e*Yۍ0f KTǁ<~E<&vIGlu=^P(F0F'_.0/-p_ /ƉA6E(m6n\dWCϯ BNO{OKyETifS½Gj|1k\U>Ũ ȹ&Cn}Ꮽz4d#0HevKzqXWq|K4o_ʺ.vU[vv]ӵ R3isjW'DG r)^ޢ0ŷ,ckg FIkO7[YꞄUӥj=ߞR8K.w u{meX͋hER73[Bu MhԪ8A=~^*涷u &S^n[_}Z?T//g}g.#5W yn3je"e D,A\y_2h)=ƥutvkf ۘ״|Yh Veo޹oJlΤ#R5'-эy}bӮ9_}~)/OZi"6,ʱ7WtV[(d\.Ycڼs Ǟ,R_No6xR/ɖdWZX_ NW]|~;ǵҟTBe4;1bEFx{-?0뚥VATcqk<^1d mѢvtuWL|d:J+ulvzi]B±f8*)CH+3zD`k[˩#ϘnߘSf[hb{I#ʴ.~W W_ }SwV~_7>:`/%D g-4E[iWE.D7+p{0m=+۴KrHHo7sS\0aȭ]WnP˻onˍҕ){=Uk&]tr[UUV%<^C|~?~M{Fo hVo #."=kO˥k@K#E,V+N"n5E<7iO  <-ee\ck<[i> Q.n`ՙER2ĞM/l&Ղim,8r"-1տ6Af\cnޜVsNC]b䈼+u߉94=X䵒oˍ<׶|-}wM.D׮m.t[t &l #M+qwKuolJKمCn柢KN6ZGOI$6~d uR>~wgF_ ~( :͵'QEaR2{-|1\x~u#1 Y#bT~JL;O'-fv1MmU;5lǨY5[]&eFQ>S\t][{ȫgb-`_Rnȸn~M8F Q{OZŻh9h?g+Gsis ܒp3 X-|[NWc~>s7j;8*q1k{€5JKu`{[V]?91sLk=xQqjvC גnoֵoQ9qvn/櫌-2rw 3ךaDt5ľ rkEL۝+׌}m>F{6p]I!d`qZ(DCɨ+p~U oUN21qHzY5Fa7ɭcJWԎ{v/zH? qFn=^7q}ד[{l\`qjT`-_( n;n1;Z'KWwGmI G׊E?\7#A=jeifub|<Νd {6[s E/WOs(F6s_\=j,W;7}ǃ;Uc'W< =[G?_JFI4W#ooƯG8R1#8`ZpqϧY2gI 9+A *X|5H+ SJH 3Up:j ;qZf:y1nhqߊ8׿ZGJ"A4!jȇq#=G4F1}*{vZr@GPyҮ$8qҋԬȐpF=*'p9jr}95ib`8J>ĥiW,ÚVyH=VH6B3JѯaNjd8<-r1ߥm[8UFa Qks*d- ǧuA9j- Aa8<ձn׵SghGӃbZùiӌsX筰: v[^t̸<5m\b[1|>荢;f\.F:r8؜9`q5ݒ$u~Yo6:lnSI@-cOm^W8 Zo3<?.R3K8X'beO9ozkJOV< SnOseэ[aM$H0!+ρ)T)5g2M3fs =п]zb]:~XZuHMombe&W)H4#tҿrp9$ʤ٥2nRv_^|W֯RTҐ+V5lx >(j [jI*wW:w{q}p7אx646Ӕ;,l~1⬛yv;Urw]xVlM#(y޾~> Ÿ2Gt^0kO $ku(ڻOU ZH+哟=oiT^]cd9?Q'_}Žq :!G _9C[F* ~{W[2\O !e E%gƸ*UTZ_"kiKZ[]#C6WsWK|=o,J;!'lPp;rFܸ}~e_J2L0jQZieSn%G^D?*5 s IqҾ@qahOzP7|&[ieDsݯ j72FI{{W#G X䍓~4j5e$Κ֥t qks+rW2-&_QqAGKTJuc4}3,`ЪDwp9||5agbRQr^AR̪C]m}Wmr$_Lole8\ >HH3,W;.v-(cx9-z:+/zh4|H:AOI+{W`2\. S1**tRӚJ-+GJJ1~f\N\7K߷oG EcsM!1gԓ]:xep,N5>[TլuC"He`*VdJk''sRW 2n2|K;KoDOGpFmZ&ȏq;#lc_ ^26bOg~t63dEx&0j>0osV *ȑ,pҗ,b0V:C̗e OŮX{ƌKx;5Wo/ ^[*>7g1_"Y$lGkK#&2[Q=sa_zs o~S78Gxf\Zozҿ5dN08{U1JWucYi)GZ\9kYOrx5n&Ka*[z`) ޫqG-#zi|g,m;^I7MHdV'u[{hvA喭KO$0cVfqH]ý|F1,2:5ӷc6ṓ排[.}auhV91ddsk^:ږt"|w+|`WMZEccļiZhy5lot@[%l>:q_5:秤H*`EJ^{ 2Kp>yRϥaCHogE"vL̼+Ws+?G]K6Nۙ]1]H#a!WRt_n];rN9^ktLfM̭]׉kkEȿ+U|3 3ZTMtV72*U7+'ok?ǺO|ɛHs;sk<ƛȅ$s[kk?>x>VP53, RHÅ_*km XPxnk^п_}"bx<]4dncҼņi\]ř$RsZҩTOO:iQӧv-5q+燏V "Λ%mQʾ"|-cgе{iIn.Wj(ƾkwkQ/[Z}$Pl3,1K!w5{5|Oo+HܑŰn>9'v?|9mnUzݨ}E5twW;mKU371֎RJR>#z/=1pּV]Vڍ#a0_fᇌ!EmQVm#QɺHf(7`rk 5,lAkWY)&Ȯn֋ӓ*+g`q­ ?;G7~hEGY/5+c^GI^JQ]#]ێOWK\/z.MԮIu7C ~ek :t^1|B5BR\|OPjgh*v8Ղ{rM|hfÍou{.dB7ߥ}S*klK[B)dBLOeY9 {fYT_+WO'T^ΔwͤC*Ȍsma9ϏlxK)ͫo$V)A`f2lr6#5P[ (O܆ooZr^N?=p0z~>&f>GnE\޹_8xs_%c85K/)Ż-}8zW?xR-eefګ+7q}]c+KQ𘼚iJ -e铓kںkآRK16a*?o|)Hig|>_+m\ 1|ZwZŞ$e:5.>/8TK+z`W观}"C$gny-ey#UoEȟNUiyXQ≮dUi HVSbk}|[ֱڻysPV^CV3v'MTFq}ck,ip5V\C '?hYk^"+}NO?;Vm=]=ê[{øFRotwF-+n,̸+QۚL_nrEp5L 2\(5t-MlO1nrt2ռhmV,x.Ju֖n~={Na&as98ʭZ[^xoX,gn/V#msw<Ν`cտf@>d9ϵ{ާ3¿ ,FFɬ\'1y4m,_uv<ʤO VtեW+uďdpXd^Gi&TVb8$WgxGD;<4̼y0z_MWYեeʓa?/|;X{~!B08jqa.gw0}g엕?F|V֞%oH[y/Wk3-i^%tA,//CY#?͞/}q<]7}:)~>>c^&Wn_빳a+d>{{}:+ҩNU^myaUi=;lP)ܲfy#ѵ;w*|o@^h$w:#otFڭ\Y]H_ ߧxPJ=_StmZR5 tX́| 01\{u2N[~]z!$#jӜV̶f%ae< Ce\Y\Ew.OIw3^U^zPʕ[^ ym.|O3ՖD >Zp M.kX~8پf۴1bֳ5]4X'1ym8$r{<]ޝwsu(E%K;WŸTWݺ_jP,L>K9ޯ{# ="ݵeMۣ%zWᏈh&Pċ&ymi#__4"ƛpEz,ȥ?zon𨵱IJZ 0iUS{xGJ~4u̜})47s7oG !1=Am&w7g\O&HPi ,`$5Bl ʦT'zW~k7C` Ig׫**{[\l|>VT WNV?-<24xmK+կơ[ܾZ aO–\ +i:yjs"\o*eJ46AR&$a{4kl#~(J>.ru_y`_0e1~G/7`1ME,ch?9c{aҾмi^)Ebo Ni^м-wu)Zt8!fg @ktimզi . 'OSȸfcT1=Oj}o[qWu/"t)c~”0y}**?Qn=ݿb'FRKKCF9еȤR{F͜qɍO#?DR"Ӭ{5HqN߾kߗé]x ^e JC3ZF^Lڽ_?o% .ີikh5s'j :SN[ov<̲}c'1ɼJ[^dw]Bzaqֿȿ <)<3~W~?Y4K%KZ찿4bm 3j=!NՏ<^~ j glVSD/;V?7+jcvUO Z/wꏸ3)7gfGk?1/=\ƒ{ [YF-$ß?]BZ,nWOe[՘t5vEz7Ձ1O XLnN8~ƫ_{NO j_GԬ1]F ?m(u67I'22SZ \nXJDU'v7+}ZOiɓVnر+go8kǣ,n}8+El99os|K"'MZZ%Ԑ(y뒷%.gkզT 9uoWmt +}>]%!Ȳ~Njׄ|Yq|At8KkToݷQ_u< LĿQW+`w{g=*σ|s Oipn4&]V0o'ҽKx 9J4hm%EzmKE? 4/*N:] %ۉ>\|Y*iMs[|7*QM}6~?f/٣oOQ_4<3<)&U4ҿ~OOūIᴷc#Jۗq'J"Ix= TͽƝYʪtg*:Uޯ}o)h^{yoBĜДV{mx9jU(F;} +>`((PHޔ8jm= qRGZJ(NqsMq펴u4#jm?)oڙ@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@]',p 2 $tցNsJ@c4gwzTt(ͷ?vHƟn?э\aQ#Itsݳ-{ 737~joN@Nz~xhcuG_:W:uA?zـ,FO*~n35J:Y%3}NI/98az$.wd8559\)1emN,)5"2r\ډ,9+.]K4na*lv/6q=sP~9pϩG?VmP,;v1@ښFמ@n>ZMTt/׊8y$sћSj4~vc^s~`xN㸭V=@'&:t7:\e_cբdjgNy$?g#.@mv,{f;#HTR;+iˎEt8郃q6ӀÎMu6r JmN]N9xgS=\͓Fztȸ=Ve9\:֚0;X OqҀqֹvuGER>UaCzτL]^0fk3T]g:sW⏒895Rr@$V)'= #-IbOhGl( /~tDIh+-ͰUϹ*S$cV !lTqR O?L犴_ΦǾ? 0(ʱÎiߛzddUՋ܌5&[$uZi=vrqUGHcy ΝZiÒ#y'U>\`dOOJig\d}ٶlt[`=tnrNPqsfw}GZ[O\x9՛B@6G9Y9Ȣ qLf?ɬ z{p1u=*g% ƩfGֻI-#~=#*f,ԂFx8Oo'`_]LǧU N_ҩ;c o^zT3V;7-|~ Sb'd)[οQ.gZ,5˿ABmY^nq_ /t蠗qWVz4nukNagc9EnoWvpxԊmݷ3C>'үfr3Xzֱj=܍){hwIJGnFqAs\$mL9lc%H9٢W˥Y0ݝ5KR1L70 t q+惷tobVYZO:c!wG2IƜݑMby8o*Ӡ_?-~\̦\FQ{T;`T2˶UW$*Zo+nGp' Cҧ}lkK Iʎ&lqlo'y-Q҂ɮ¤C$ՙ'D#U4,h Q7 3_О*^-?19%ʣs90r9n{Hm%#\.3^=Kʷ;צxz{KrHUUwөҵ7{~gXj&[䃾 (}߉4tk/`l.eQH,ױxJl{cܩ]:p2X\Dpҥ?#Sf_n&f ԄzOvh&wZ$*9}gga5KMK(q_ 𦵫2x I_<}&BmRӔ 8ۊRmq>܆,ǒR|-K?>qNaޝ=Ug/9z-L(SWוjWwWrb:dg5=Ƶu<ܱ;}o̲d?aZM%)n*\7^&幓pj<ѩ2]vKS̗Mv$?$#b7~,6S2~uH/?/ZHa3UW&'[R,W<`J}le>_'7ҳľWKxvUhb9y'yGsrq^I~Y e(wm|7za ks7qEz,jSZB-I"D9 ?pϢ+D0'rrZ9NJRQpmLyjIFN 춺 ;KK/^Bc.yFYv$<4v_6/_6xᏊUWHq9S|02|2`^!Qq=\q)bFzBڼZpL l ۋW^)$TR|7tu- }#Q Oſm 7]ΪTn^?J0Y=>"ajS俼O p1 x܋7ux58.YF ^*);+Ei̵!*НWz#O:BRO21iц9ڦOh|Z5~f{՞dn?/S_>/1GD^Lo^xE1*3I߉lx3$*xdwֿiUy-Y5Zb+뮩oW]jZ73;/O]ʯ$q~V摡K0A8k_^1c*t,y&ѼmE@n6S}k8ゲ&t91s|V}eͺR3N/7,oB v@81uv={mI?%K&e*5}lcb$TF!wߞk+BUv/o,ίF^?Zsϱ4q_VIJLEi'ѕIYpԥZY;Mgֵ[Xpma#`f!+7j cw^8Us?h|Ak-ƸKGRђ(m:<zגq8VסIv^G{úi DmN}:ٔmKyۺ:+ynBp;׭.A=h F7ZWR2zڝ#k{ :F1"m{mZsGma"ɂ{?S\_t}N#aY22zu5#V_i#ӭL#mbzhҩʿeR /|sh=>ilBot_q+⟊vy>=;GW8W~`_Z_k/V sySbW9-_cFbUJ[5PTɳRi(?y j^ ^rm2RU2c#Xں]宊b-) ֟ڻ.diAS`>¾gz0-ö`nalѱ#$k\2uu2$1T {'ׁ|H7}z\;"z'skWqWW8[=_"jZvVˬ)7D2(-{)|J:q! ҕ7뿩w|7edl|I 0Tm-ڼN]2RY~]g5tIVQn ^+E/4Qh3?1 G۷xƻAo/>IT{!ZMd\nUelv"[&XNa^fYֶ/h#-4cvUrSo^pԠ9?菏Qr)WNJ E+ObCm:5 bV#D0 _PK j6mqYuaeʯ- ^5m؈}~JJkvLfyk }!nXߦ͞j7ޕq#x}Oz_ u\}Fݹwf2Wg_z4r]&UuO cV;<=>isQ_~"Þ-;,pl܏ǥ}#y{-m'`ŭ-3|^m&OXq*yuec}ƙlegYIu9E/T*Ke[\𝥾z-# eU۝!~_h|%3&O?|ᗁl߭}uKurֶI[eʪyW5* RUv8*QKKY_}ik &ʱݮ˹VR|y#χ"5աkg pEp ּ.!LwqQJ(\pgI- Ǿge)b~+f#W+[[moSr[]4ϊɡ![W7 OFDPxfweTKcPI&8IL'$en~!`q_oo&W4vl|G#:sh,..hgeLZXGV;7.VwNX\UN1ڷbr -[F&Ğ&QjmfأXW+3_uu4 ۩dm\pE 4;_>glc58hYDWwzqx5OxWҭp 7DZ6c{_SP^ڔߖ6vԗ%:bKvOZDػz%E%w_1+?=7ūE.wUvy/QJkMn(md},WӁ^F24t~ ,Oi{|MO D[ nuOwZn`Ұ% t}]Avsm3^:Ɲ"1Hd(B י^mҏ?M}{/(Sp0ZZӬ=վc.nbuK+|ob<ޒ[*YT]f|w +[$(%ϙzׇFP;>oOu҄jIƤr_e~R~֟S]ek&GQM±_o dSϽ||Ys:DfӬH;ٕ_zNXi=o5Gkg}pv2旜hyXζ7O^G :|jxMoپ@K" ⾽t+tF? c?~}P$v+CaAj7ڂp|Ʒ70z4JGC#SJvG?#_'T?Y-}YC|0A7_?vugKfuV,>yWxC+;G#X].#Z꿃_\|\4|(uPAh%dO/NH_ʓ1U)8ۤb{3NlF.r,T5٫\ƚ {Uޚm7A1^mDԵ2;-& }+ +{M67.N vmޠK޼ͬx8nuFJOI ұƔZ3i?7eYjrOo˹fӭ"Eڮ] xg> [n~qpʢaS^AvZ]'J1GQ2(1.2\^:ҼQT|h%͛WO^hc *,lۀFҾuAu5埂m㱎UhV5`7.0 ]?%|"Mee,,M5ǙYx:lM{ߕJVպ8a7iK޷MV?_}³^|a0~cɮ>]?SΣLo[j-ѻWO]CSSтS$jdBKA/o֭lsf?7^zq^>iChԪ$b~=].'6>)Լ54rHXy&F<-h0|[noOԣfEf |Ŷ6ĺtmxTq_Y |Olݢjw>ea ʍ'x_Yj"Jվh_ļu'BqT{tt}j[wK}NVfJżq<=6 Ծsex<"x'д i2y+yjW7<+'S88IN^3ۚmQEQEQEQEQEQEQEQERT[:hM={@ H=g`m}qH]@sRg]60qץ=UK'? kx;4CSF9sPaֻM ~v\UvG_1fEsͷ3IݪMǞsbl 8uw\3_nǽsxHI#Rchn\^SqߞEd&#9Ma_pǧZ觇橉V9 XA=`\2I/۰WUO UƾHڞ3ÒzF=j_r9ɨ$5VMIq$}+99jos]œ:Zu&S9<1ϭZ.:+Tծ4ؤ={U}<}2ke?Uٓ Z>mqJgٰ~Psly!S܃8ޡF:3~h6Mi=W@iIf0G^ )S~bG!H#A8'qiaYnyg+dOi'עZ(#kZd`\t9i@(Jw\O+i.jeseOM'$:x5v9O#[kw 8+n5N! S5\)?#)5+wG+BWǑOŽ_Oӭ!=>`k>q5j2ta$)uc:t!8V_wYseFj k>oo³(b\ 0n*{0䕒:e^w} r;2(4oxktBS\ 7<=+{Dխ Ef_8#8?{5aUS_RؓT֤pdi6@_MjZ|gZؿ$7.cڈ|9m5ſ[GU00~>c *u97(_>K٩_s>Θ'U}zW%?-/+ M›\wS@l`6}=~Z;+<i6ȗ8?Q_Jxn{+؂Uhӵ.c(ۥRM]??+08AF? 7ͭ啝>j] f_j>juԪ"H ,'_NS#zgj3jW6s8ʫ~?'ţZVe&&8o''>`}3C#ԸFzW8b:~ԡ>_zgGz\I¹HUhœyT~A~I}nfcon1W3x.Sǽ}KҢ՝Eur@1W^^h [s{to;60<{MK\)Ehݟ㟅x ~x9y+3{+xĒɭY]AOlשn4m.->G%csn_ٺڭ~gKWV$!ZrNk| uU1ym'{<:02Sa(B6cNvݤ"yW#nCmONo-s=.p0}+Z ;O=R\,3ޘ cھ|akx xf8 Tc(EF9qN+4j"+ʹ$3f +JpOɜ˚7[+>,vl>b_ksLb˲ڑn1vJ] P̳t+rkuӢ<DWqs1DᲾkJyb}s0M7G|\#/4e1UwP~Kp2j8T7Q2c.o~''R77DX|5:ݡ!'*S~zNn$ܹ tox޷m2U,~WΒrWGxOѴ>1QZܻ`0cU!dV8qtq/)?l[>'xLi4;0}0|n4[>K1vPWqռMD]i6٩Y!ⷆ,ܰ@vJpqaW㹎eYkpn0ּ}!;rfmwD #h7+<]m!GF $`]y>l# c$N7zw 蒥o~h3 .oԋKޓNONU1reR^*X,|I[[6->MeC3BȨw$n=3ﮧ2[n<|@d # Z6Q6v쏃hF%X~_6L\w W cdzgY~6[æ#G'&'nz>K;QjxɺH 2km6geϧT=6^|i|; C@׭ȷ 洷z|PE#YcrcspX;J:w>Ү\ak)Gs>7|EЮ~K᷇eK[25jf83|OT8cw0&'RQMuč}{>|K[ g.YmDdf6lQ^z 4xR,-ZVT2OJ ?i=:_𞫩Xxe]hfUm3ybF.?T?h?;v&K kKO62cwddgm}M?'6>-nҗsU,1ݻ*swRx:$$ME:]wu}:/' SmGx++ZcTRԜiF4|}[RwCU]#0yX1$EZ;`YC3ԑ[=𶇫~VKV!'G<^-៊Z׏|'g⻛Y=˥XUU71'9WeE^ x&z~iWZ)^;6G@GJjM;QCqg{K8|wE)5mB3,64YI7)%y-;*ϖ ]pq1 Җ}*.{:_oc?b}B f[8\嶼hUp4/^4HE6AzWFlH FUy# ٮ<ҥ->ݯ+~o_rpmz7ҾcƏ5zY7˗_teXEŘ];sq}Cl@#XRv{g^RiF2\Lv\_kO~K{<ۙD2Z7 VW}3\lk/xw, )^I7!=@NO59s>OadGxx!'Y[te*@&Xu?F;x`[hF>YdVF_1jnNYGej~leCVy{FzW~i'O*Qttr`6H5zӯf[vll\|5ǺQ~ʿ [n<;:,X2}Ϗrc_Gv~~E)Ke~] K6g &RX:UeAO[)f. t.}4ni䷕qg|_9.o>ڭ:x| LsekVKW'O 'οIyy~h Qn~RLM7Þ$BM[]Ԯ qמ~5PunL:WCk4Bk6a汵q H,iԮ3T#&ão-tssqn5kz~W=M{XJl$Ѭo깯g]lIEx+ٴnf[F$UOzكMf=~GSn(m E(Hdݜ+\cOčsmσoZI h VRܝ4j֔/]y‹ٴך[ 3Jhؼ]+}gJmu|Aruk=cPvKht6q,JNiX{v1] k%ދ3> vyB@`#W4mzEK6;> gf@#9^TJ41=92T~&6=g"铪$r[6H9;]5빛Pû9AYZC~FYYW *7k׾&3eg_ ;[|ZBk壮6Q''Noq/#xqS_'+[|S{'>q gBXJp\vHZ|;-&þ# (cHIdDQ4k俎3| ^ws`LEC6^).5 N9H\UoXZ~_,tb?~^& ]l[ҾҾ5sk_ø.XfΡ%PF_2O3sk?d||1Y3iMogڥ8uK RRZ{TҭMK݊]O[ڦxR ]?VK9c8b"̀:Z6C/Gi 5dg*wj^4KH~"jc:DIInE^pl`b4k{oϤ\3M$i#mV?Z/DxH%k6fns 񟃞|4pU^Ja]$~o#ƻ6oc+tVjs RW+^l>&|Ht]Zi}+}29Ok^$m2Bxb8XjֿM;߈obMf+ky]ۉ8~~۶:VD(t_Yk yj6TQ0Qorc:x8Z=_S:(B*D@ $ 8:;9+ӑךLp=TʠQP#gӌW|=[xXn,#HeXRwzt1ZN"J1]YцWT0ry*niXhח Vs; 刘`s_+6O3Ύ3^_I"f h𶒼+2,6ܥuyb%|'|Af<H'F5f\ҭxn^k.%)_zi-T%Ʊmc+@6<ԼEM?++fQh}#ixe ro< = [[*1BONkx@!w$5hxu# 1I#@ѰGl )cn.n|.`:'ne>-R/~f^8xԩSsL £#L-z'} g qGHי%FTy#ҿSj_Xbp_a%JMG eHے uQEQEQEQEQEQE. )XQU9 8siŀ8+<xqmac1$l#{gmwY C UV%c\.o3c5 %6?h^|Ez:e3@O*6|dW~͞(kQxgN#V^}J]idTUic "2\m"1A |8xWljU,ⴻ^tD~VxFi[ n.6;-yEdžm$Fڝp]A~^Q1kO_<=WSnHGMrqHVwKmNgg,ؒģ<1'5/gZ5ɠ5Ց!+ZO<=tjm͡6A'\UWy5SZ3=~h6&J6m>L^EU9=HHqjps޽ÿQ':} F5q$]XA dVECsI;>TCqS܂'\c30?Vێ+ԕׯ!9NtU=Ę'8U#%rsקdϜ\"aVM0E`^@'>t:ۂ+B G'+ҥǕVWstC=|b2瑻'Pp遏A^8EuJND>7F2{YM>n z+t/=X-pؚi 'vHZב?9ۊa U $?FgMG3u eճ||ÞwT}ߑϯ8Qd)ZIs׷JQ)p |gҫA,n)|㞟U듚]Oqs=˂V?y/\cڳ7֗CSFk #_8ڰ3jo#n Gzti S!ZN>+b tu9^}hͶwZ|~X>ФcrMpwsvv\*gzGms݌c]iAZ48_b2 +ƪϠX)#ӽuvmosJp1]MW>^|cԦLq譓3rV frJ{i1z ̒~yjb}){6us!rG^=ze (")=Vխʕ89RѢFӻkꟅȬ6 zSxcx쟉*ḃ j|!| RRVͣCygks^laZ +?{G vI]BZE mRN3:KcCi{ /S+ˣ5Jo3 \EjGK[,)%d=~Q~IKq7S__G&-D۳%zWƅw^%v2 b+cSع>IJ{.5Ny|,]x4mW#z 쭴s%͸;#wAW] ܶKm}/X Dy`O'_xg5G"\*TwRi+aN%OFG0!uңܫ.3gXaԂx_`Uԥe\ԞVoymE+"^іxQ*iJ)J7W S8ϷC6Rh\+kȒ5^_/HR;eR^_m5܍iХsֿrӗ29E>v1gVPAqpF?h'V Mp^;H;@aBy%2\)L9WkݏIoʱJo{u^QEV|;i=GަgsZow-s y?} mG< YKt  ikX6wI׵{hw Æxz8ڧ5Me|<ż]\>oyoK6E{5ǃKO9FH3^[5ߌ.{u۴S>k;b5 Z1{] Z.oVMF<d/Vzx\4#+IG-\Q,ь7׮|;OڞiY)Ǹ ӵ) } S_qTN)< Ouc#VpQ"' =k&Hֽq\/no9_[n?~]ܵNJum-cYXbr0]cx|bFm_Gs*a5w3_ 4/{exHP̜IId\eF]撷-''xg81PE~OSm6O;W~F~_TtO:h `R`e/I VMDmJw j/ KX71J>qq U85+ OT)SO~n~+W0Ub*7wc|%?PÐ+Lf5,&+,M/)y懊X|^][;5WvL+~^,~a ^1e8#ψޟe*sl{Ϛ?f|K<%ՠAgu?Q_d|;..LC cz/Զ0?wVivd 0@;W^C? !<EZ I=֡Ju՗4miG_"hNۋwR;c56 n5>IcQtcS`(. fX$6ϻWZ'ghn?W(j|&MVMB9>3dWoJ.Fc>Y!` o½H^DݮR%(F ߿$}CIm ,R12rH=58 7G2248[G6d0FNcWV뿡N#ѵ_7RuAki Yɲ98|[o]XRBD̑IVe.Ήo$p,|I iWW>*dӭqjìjѳA]^֔=deΧRyƬzI?iuK aЫooZpIuHmIV*{v?EoooFf bֽZ޳^n,jwŶ;O-s]qIZKwfNeWk#ym<^ kf6n}럀|kMJnw|gzh-NEk piv$L<6leW@+3zV$1'۬½">R!j@ +_җC}<[ʱ8Do=WGe_~#xieiW1y vfXiA0V/^en.[ 1"hXPḷ~s_kF]ᡈE+(97";xGr ;U|c@%A kՂ~cWѬG\6{Hfn1[XLd >_Z()6e~QPxO_nO??q $l^Eڿ6>P3GaxoV _믫!8fX"=s8z>izD^)iz(m\WW][#NѾ v =B+7 ~gc~OlCFQXq_Eqqi`T,SvN7ik[E+YV+d6Q-|As ;Ĩھ׼b'X.m/و¶x>mZW%KyfG(S_FSB+>eg}^F0g_⌜ogȾ7)}d 9ܣŚ.8?J3Ie;>W80;tc<&S J{_g~n?7(M}%:c?=G|,lmu;)n]A8 W: VӼG[mmiZLSlK*!6kš>nQ-ƆEfˣn8V;8#A^G,2R|^z=+޷DM&!U~z|A{+ƀKSSLs_ӝ4/> 𞼰Akrڀo0,@$5e|Ko<5#|m'ڧtcq_EURMԷ39S*4$+u٤G!$R97o@Y}:06zv*#i#k3.:W~x3Dֵ[č-Dd{W^W[˧]Z^B^Y]Mgqm剚9 }%l= fX*i+_kb)>#Y(&(M֖!ɷk&ƺϨ^[Nkmlow_]mk/3Mv ͹v;#:)o QυPu(M~ea^K;p.?֚_K~goZO OuhDQI FvR[|Cm` bEiBPki~JH b FyO~t;Us$Yk7h:TN7{+z5S[[>/ |J7x,ſu v[L^5x!vfK!-riY I\F͞æ+2/5I _y\:q-W_hkբ|7Z};Bn'I]F%F/s;k3~.y6 ZZ/-ݶܞyg^.iG;sRSTα{N Cc)t0*2PU#KJKzs¶6m -V fPf}9v xw+kKƁ4췗Jj3*R#moߌҡ.?xf6¿=.KynmPiQ=>pʔӄWcԡ?o-chgo>K/J1˪І_j]ZYL&}p]ԴG+C0ѭ$fHAYrdsz]| ?d0rTFqQkGsl ቔ?5Eƶwfz]GQ͙DS/^hBlIW ̤.MU/Unm#sWJc'{*Q|6ОLKf+92.8aDkkŃ\F~Yrkҵkm-V8kniem N;[}41>{&ma/Mk3b޾kz3_Ώ*/iҋ?ڤD3oYUBqwW?AOVlic5'aMmaxoU$@]]tsJ>ڧمOH|sg<& ^|ҩ.}6QKݏߩiLF67#uo|5}xskؼ?P춲8!̍^WDr]ASxJ־=q&)ƊMojol-x:Xt_m}/&|Dncev#o9牥1KU_~ Tկu95ű2Xa$Ml@FhZ;q_sL*Um('#MVo|q}~E{j^'U;Vk]pkᾑ|ac-0Fu/)boh|UF_W?%hޘdŴkmS/Z4v7QW17yYkO?l MVQm6$nGYGN Y~A:t 0Gm=RG.ARwHwq__N ݽ5 obrݘ/6GC|{)sUI1ڪK*oDv6˩0X2ywk!?}KcU(S0GEFi8/mET[toQ[cw>*se7 IB:~<;cD:t/¾NޛKFwJ*xM7nw/41Wk3oZ\Y>bNvn,!yk"47mb,*FA*Ωs_yzK-?mZoc?(F5O1hߊShllϝ>˵>]l.#B 16>oRu*:wZDm{叀#]KXƠLA$|,.ޘ;ſ n4!xu1kCwJz_A~?_>2.koLjZlR֋G"r*Ow|EeK?˫H%\]*ɳ":8yGn߄9ХQJӴwҏ?U,>8e>(dʹ>H+}Q$'1Ӗ&gP'{A >\mJUӘܮc"xX:VQ׃Ub#z/W'X5Yd 6,lw6MaAB@\GaYK[LF6zT:DV3u2{ο16NFт~wAaR]pk-׺|K2Ʋ&UOנxgBסigq 鹿|N38Xi:[hS>W(՟(x6-2WV -fRr:s_/"/|?:WO>r[&f **6 \Bv>?yů6ׅ5'RHeTr._m׌ͣFRsͥ(7vk>;x.⌾Pyq$B cd}j*Ϗ~'xF)#k0X̮\#a*KpXJӃq~RusQ@Q@Q@Q@0?LSvGdgCQFKg־c=]PYkzߟoo]m\lgxwCë}BoVlZ&0NR hxRe\/,ԟO%~¼- jX|o~FwQZY B*U9{g+uqtRgGo1V:#qPF-.Nd 1_w&NWagb[xѻ<)n뺿3 F*Jjw,ҏ aQR\/~ti wj#CiczWi-Hr_!cyd}]9cYiv`F&S\1]4+P?ըG]M dK "uIl1{ewwfWw=r9|9#n#@ASmpWCrXcjI/?'XXNZЃ'9vH4j#vG_1>^U@Z8șN~@`$P{gyUfu:W H3q:[pOo^+679/g5ecS-r ^shv'DO'vdVT 3ʺ׶WǛf1m+"[VsK^د2zxΧOQ5iq?Zl;@tM;L\8[kUP 5 |#M@\RP:glŒwn$ޤ [`69\Uppv8(8Ozӊԯ͌#Z%ʬ9-.)orzqBb#8>~7; ֜dpkhimQNG"@54; @]6񚴺mNJ3s=ks:nF쏻\ <0/ﻯ8R1<>jGOQ g<Z)H ^ֹKFFW_㷧Q\ y鎙+miX,㞕ܱ+'z +8b"O>R l3OCXwNG^+9ץo3dnyqf?ty%`;ӵ@ n\`w8Tr֬2:+}X>JN [Qmt@PXoAv[ k^qbZSV_Rnݍ\vL5W AsJRK;_x8RvFKw GU&% lZs+9#kf?7Ôj2 }yrCs@SѺWxX}?K#ے kL$ b82zj:r_ER8nNgvzlG$~eAm?Baiᕑn۳,Zj3Mfbh`cm忽=S4䕮V)wjWq%lG ywohyV"n1o>(ǯ?lzנ0Vxl'.qkw^X¥ 7Zuṳ#VaY<3ix-hUסsfw_|{mͰ1pI\do?e +/Ś޷=s WqX,etpri)Q:<ڻs>iQmw, bOR.z׮@yżz*JĝGJOxܟ-ɓ,V"9Pڋ\2kggh9`s8aӵM?7_~qsAvkq}l`u 23H=AL:N<|)+iwQLT9/(7-xGQWPTw|jZV59QkOƈ2ʪ&h4- [`u $oWp aB]3VxR;IA2Nq_=x?aòsi=.cJݽOcF {iyn}-Y*H72zZ:2""FuNzr_piq>I_BTf-Sb)BqZy>ˊ'm9e!rGCW|3F1>}[SAZ6>'?bVfEş>Q`9{mÑi5C$q^7%%B]̷[Drb?pa%u~Ǹ~=WYWۦw%{7ӻ5i%V](N+|6nZ< q_W? .P3m+^VƐ X 0xSJy1ziOL Y>5I˙4._yjc%yv\ iɽYS,WZRpueN5cxߙ5uYx\TMYYs'.ih7`]2Oom+78zV X+{)+#~.n^7^+?]"OZTney<"ܒ:˿];{OxY]spǞ\ֹ&6gr#2ix5.SωUl棩xT?e*}i^5|+\g$xd-$x;;MJR]ĕ濞8^HncïiziwJ,$f ~cҾICZX<"ӃW=rTa+'QoX._in߹# yjRS3FxxŢM:.2k Ti"W]xWQӛϞ <:n[KFO 3,8_þגp;9J0[y\/t70֑z(8))|My(IIV8?V]W[/! Zn4;P  ƾG=컉2|/KƖ{QEʕtץ5اDaq>W+˸p/|hN[~Y:5 {$s]8T]]YյEF&Kk?I˷~AfuVMvE].uo-oI<\numwG/_fE)[&͖k ȴ_i+>9tuYeïxxbb}BWj&1WS䞟3Ju ]c]d7776~{ )i!/̋zj0{\U;31]J_ w6eKK mR'c;fna܊K7O A:z}ǭ9%õ7g'dXhj{i2fŠAwu$:c$FoLW%7[fhѾoƿx?ćt&sbI3&O9Fa{[@k oZs8|Td\?,${Emx8]I" 9GOsq yª7aɭv 3<y_mTg:2I!~evhk]i2HȷXI s(w44F)Uq^[i5v=fWc!~_qj٥z8L\dxxR,^*#LԓA}m۵Ҵop~_°eb8/t=je, (W1l/eq 9vWvolt2Q/oh-6+g\004ihS^Z;WM%II;$:m_^)J,$ i` א~^!l<=es:7t|5k+:ψz )Eo%nk(f6;Y~ξ%>,^xDo,Aӕ2e^]昌/$՗O^6sG0L.jqGZ_igy,"%Xi܍'5?&>ڧϼGf 7׊\K_%V:7Q&s?x+\:qzI_}KBӦ[JXl^Z*}tr6o!/E=Vܕ޽Z]7|#bJ%Ɲyjۣ`z5FS;9qXNizJQ5ojD6~"ҾYZx[yB2Y~k[TԮnθ//JfI  Q֖/C zt\46nrW<_m?HZЮt;o.#*fOIk8s:b*K{Qn[-$Ⱪcm \tݷiuäExn[2Ajj{r!,q޽Gu ^C{.c `dO^:ul֙Rztz/-jox/K3bm"8?hӃ ꖤ.r?>M::αx5֝nY-an}ĺle%u{mic:+7}]>B5nbDVv8¯a_V?m_D~Nx| [yw4b;N -tnȫc5/? <hi}%孍ksq\ H ҾCPω4]tzoc ,qf+:O[B7&cc*g~ V%-w]{^ѯim%)C+ƾK{? SQgum^#F̉z,T+L? N%6/$JJZuoEs+wh߈Kmb#jF]ƹte]a{Go k?<5xU f@kuҹv;bۅ}ayy+&ޕ+jc?y9io YjjiV&y4HW@ oj &$Mh4𞩨?S.ɓ̾r>Ҹπ~Wƚ̒Mh+4t^.GhA+=M B"sNGwCm%ۆ^Kk.olLZ9[{A6lVmJ=ZItЈ"V[wqujXZ|ҖKȬc+?ZwLV}wQk4& +'ͮBq[}B OF˻Бȯlh+lk+N?#@Y{ge xޟmhJ}%}&G i׷.gmyyg *1QWݿNK?٬cPBn*7Ҽ pi^Zf]?O5b96KQFG} qY.XiUȿ 㦡]oi[>KZ]2nnWFl~yC ov75sN' Y4ݼUK[%ZQ[VPak\|5~5~տ < MsosĴ9e_om>G@ӓFR-ffiY]_j9}#8|Tо=7ַV^ķ1+Am_b0~)}v yV/{~~ #F(WxIeW_?.oQhS%J-Lp7ҽ3◊u}>?;eyu2mɷJ/:v|_kK`<[{ea Ύ6->}$gTZ [݇7vq6? 4xv8#,j'B,#{I0~6Io_#{ë^Q:AfnJy5o%Ko}.!ݼFGtʣ+cȯ|=kiVMd]1Ƹ7nVUvP&w^s x[my ;`Z F1|WJ!co>P.^0;g5~"heֵaf?gcmǿ_%G}};Wu  ?C{yL:U{]zG~c:^7Elu1j MՅU}b̫s_JQIINֵ~sby(Ԕ]m >)C:-[V$1k*ƽ?ݯ>1x_ 3[w"⹽k̬>f_wd׆USR )͑lXaVF9 5ce"kb*e|?,W~rb]#}[ W3Q\g_ GrS[HUkMfR@-ck)WǏ1-O>Z#Nֱ_0tvZ,$PchE h~}XZgc4ڞ=GeNYTܼf~ RIR'Zة:U~ozT{zƗhn&L.&싾.B&l_? ?mZY\*owg|-j މm/B6c 1_ge7+9k6:ski1?h܇g,Eq|: +4,bIi.aBI_9hө*r3OW^YJ6؋-f>cTh >`|b1az]a5O$qvk ݕGf0i6.oFxb'_^xnI Kc*333Umxe>YPpޯ^Qeiֱ̪HܲWq6Kjt9/=1',E@#Լǧ)I3r ~JFJ9`N+mmmNHzۏ_lʬWq[ٕSmƍ <)g>uGnGm)?+J>;;bK &l?JgF:vÂY}v*k_^*=kqAt{bcf[-fٴ3yW@&Z:֛k#AoxeU;Z_X9ֿ qU| μyduž QG1n)s}၌s9S=)Prst>,7ץE`@ E>ߜ})( *](NXsvѣXgYTa}{@<*c߾As ݡJ˟/Wtp=ecʰ EOYh9Vƿz{sa &8w4k$i"I0a+&%!2M֩,F?ɩBPh5a&1^BfVTȬ]&;xQ޽+@Т1c_8q^Qql3[K,q,q^g4[>+ h%=+m*2VW5fRN da[%)e0Ӟ?JtcL0[n8X::s8w>G=HϨ^z9]z~F6oJm CJg>ܝnjvLW1I*5^] 䒼љJ*FS -gazWG} yp{cjAs0 {r5ӪyiJ:!yR*>=*&z)If9`s85iCZ[X8<Js1һ}8<+ϛǣM#<[i⹫D#;aeasߎqԓN k!ܿ)ַݷ+~8Honds\Jt# GՀ' [H8݊ʍ?$54VRe'oJF)h1bULX~qWGBMXɔV`':ֻǓs$qzYzN_2XXW$W;gW175>\_&#TN~4min> ' 1Yhwj,t_"j>Gɰ^;y;XnecEU$ nk]7L׼Qr(\_r|,,~kG,Gυ~#೙{S3e iS;sJ+En4KT֟ 4񴛙~Pvg<ҫ"b0x5n|8t 8Z.)'t.ksu܊i'|9@S>-q#,nzxW>!BG9 N2LrA%kپ,:X0Irb|'私EkXwd`F}a}y"GQ~_\W/; $2ݿh?A^3RT/4|־'.p`*k)T~Fzkq B7ֽ& K+7Ϛ14D`zGWʿ4 -V7uh% o]<6%S98ݷ WݫU:kqfXVDӿ3'ڥ n탁*2FvPO'Z}&V k -}n5#v|-Xj*aQFqR~߿xR"! Ez j :(AݽJAWXr1_gֿf_K`]9b[ڔ#v8'=ѵ]Aaα1B(oǾ+7Ew=CI Rn\׫ǼM¼>Zp5g™o^$er8lENSK}ث=wwГ2!}k xcNg.-TQp]3SKQWmS6, al Tkr?h>9#*-/x]6m%y9TF98x[!b>V9ԚRV~5،d+žh{IĞ|>o wƩ ;bH{{׾+COM$oF_MM񧆮CUYg3.,Xѯ;Myk;Ϗbs`T-箧k$+?nF>xvwZtKd*;zφqi~7u䘇!ڍx׋2\7- iǦq_+PNmn{"pGYoJTT%Rܲ]|mi.T;WU]CxH(WTCS֬-4LndOQWUqY틩PxlRZc;=ocP%B9"ok;8@0̟v=r+[A\%19%rrJ+Tl;*?o 'D wv׸ǪpXE p7c_|;PE,aHmsׯ|7iue 6ݿ_uY3W!')J1QM;o}68j\+׈5'@1$zՋ?%Iw T޻ψ^.t:G%^= ^#xY) ]JQm$vl G5w e 9a-ь'snφo}ù/)[EKIoEsV[oךoZ5x#_.sv_;}YT9JWW/<*u_oSQIO>P$k닉<㷟8NgPUo?L`|ۈ:‹ƲF*Rn]#<[z}V}De[')sO^uadB:ӡ-ƫv;Im-g'r7} 3 EBLėeDt玵UM*1ZR[u샢'k_V0 o)fۧjt*-7Oѭ,ePۊ `oZx;  J_i:4-nMǭ}+qps Xr*-XZUSJQ卵zYURyvQ[fqJ8jy ݈d]U`G:z2o,d%P_[*QcF|=M^s(tԿ5 T8ǹ5[_%{#dYHݟ6xukú\wR4: ׋\J5V#fZ(|pX;b0%Zyb^wϢVeMΧ7m5t|:*j0 Z;_4%L&o<*.2?L#-%0`*IP~l+ʝ:8VJJR]t7%Y)4ig]Ea~fU)a+i>mŴcZwF|fKYH6~U^?[ZS:UndC wkWFF෥c3cx2J#~M'T1uGtk*wFxVXҭ^ Ug]XPoxρug{BYUq__Ĉxz̑[xMH*8&m*mFQv'*k S .h{WOܸw1yMCdzK?Cxt?kWlOՙ܋%c&: bn=w7ZƤxk <{nu=E %<.:p2M{?9yoiw**ypΜ(*p'_t>,Q5Ϗ&m5->AK(A ,,*nt x\xYWac.)*$8r6@-֌*J--^&.<3%a|i\~v<9b<&6[@GQֱ>|!5ZRTP7}kQayʸRdo(mpDf8d}kԧagqY;KGN ^/(~G9x{/^Zj卶W$z~G-V L6 yڼ#mGy#v3W?^_7ڮ'L띂LcGmZWoo+{9o µѫRNOz7ݔ~GwkF~('^?NxwCכv{4iчۺ?oxR%אa0ά״NekK$ǎEtp&{ gt׻w \&6XSq{EZgxosxc2wҪ { rL~>˙ؕC}Wzύ<=O7ٲus?޾_Ԯѝk^gz~잻wk/sb[|O񵾒ɦ ˩Q:[j_0&gԩ{&N}kIdOO={+-,o*csO_❞=GSemX|8-C+w*9mוwt=Z4 O^XOMCG.ߏZϋNq wlavq--n5[!y,c۷򯇿`WOZ7m|q7<5tt}D_6F;C6I.e^+,Z|.癵 _GoW+]Yl{"+U, 5?0VBYsh:WCiaguJ1V1J~:~кZd wt Yg|.1~,Vc_5 :.oKCw#T0^Ҭm&~Z}k&MBm#PӢC$ls$`mG?*Jd||_$lnthϦ}~mH[ >oS qi/~,in~۬ޘZC$3W'_WYѣDz ŦA o+n-yywؼRvOqYS (z+=FӅ V:O$X⍮?z((޼P?ԷwϲAK#ry_&x[-ȸMK8&AU[dӚݷ:dM⛕663Pa/ֺpT!:QOW~O[ݻQ{mzstV=Q\DŽnXXTZk)H걫+MOd%0l~r ^dI͗w-YNyɰu9Ǜm` Fg_7Ɠ{fG]Iu(n٥KvjC4[?Ev$՛ng4vwN rwƷ2\^F81r?>jxO?-Z6*W3Hɐme=k-8ލ~>N~[G^m5-jMB+XܑAtb.|s'l'k ;MQiH $05m~ G7J+xZ&-?wGi K z%,i9TV|ivT Bem?#?g_~Es9aԮsI«Av>^e:qWܪ~{<״i_ +O[x-Zkvm^:沧FVu"Pr{^sMWs Z{y>q.L?Ҿ"q#!z__ٟ~ I}&}:cp2u+?~?Mc J;f!TsoP,Msmb+Myic9ȫ[IQ1ҫ'T|. }1QH|#% 쭐P])|o-3Dk9lVaG~Co톟'+,J] |q^qJ<;øn#!D"-:(u4}y{DyӷҽK*1hfNF⽧ßxMͧ:oz Qi7Oi{?yڿ37q}_VG/Z4"KUc6ە/v27+W5ҴcYk8GV4ͱt渍AQʮ}-wIVo~T3i~_C|]N&cۨ亴I ',Xğ¾kWZOw Bh^>l߆--# 6 pUg{H+$LNL~C#|6#8jB*k_#!T枕P|m!>],t8V$qcs_#LH&em^8^ZKobV/=:s_fuqrGc$mM;=ݭ2۳Ztk&Cue# ETE7v99Lt ;Kg^qp:!UXdEӔV^kɾ2k߄5\hiTlXcw#JFZm(Z-R9ZFO\c\aJs%.d䔔T̻jȮ&t5ŝ4LaUvׄ_i ^7EjM( ~Vw(ot;?XR[4{s`A~qww|q|$g9vW\6*YN},jT䛷ֶOx 13T..kEۗec o Gr+fk<^cşkW71dk{}r.ۖ+ qysԞǭ;ZJg49<* RN2Ÿ8= ݸisR*"I8Қv7= =.2ݹj/웉I|灏zL|;o:$?KNcmxL.n?g4--C l.0y|M*9.רQn^ӥ{2mVXz}Sk-" ׃|v6U]1^u}ᄑ,ed24e6nGnV{cM=#<= ۠8YpXb}'Ku^[ipݖ6q:km־J5SPk~MjEKNa8'&^?=irMIm $EJZM6F~_ҳs#w=ٟGc}v9t^zrkx͵!$1ww5Ƌ$zW!b6dctSRz3CCǃד\>V 85 #pOۨNVh|˩h쥀ָ~\޾bq^mo:W_FxX-qosUILuї<;wZtU06zpUM'`9stqՑAuD\tש$REuFb$ ȧE 3JԊcsԟ1:m?J-3Rz謡?.Fq޸kOCӻ/ZZ`#=*@øq^5z׳oj-#=1C~\O s׍^z!s]Jۓm`08+ Q^UY+%mNR21.^+ӓnk-˅~y|m(4mpz4~^1ٳu+b;c:D=Z1л;S=+B1 tD$?JF?3\QKtI]۞} Xhr Xv\sRW*ҳRd {状OQ89,G섮A;U)$Zr*{=u!s5$5_c1=E;z珽]vf5C{q֌aN9A&ѺWn;gPru4ұ2UbI$k&!dcމצG5Rwu}j2N{뜓o^Z/ ۠Vn9NEsWX EuRVG,rCk$xA{1ufrc RG Izk# 9]u𧷡+?{9Nx +oxN+nI'\?VOmLiXɹV+Nx1?a^9ǐ{ k#9btE<-}ko ⷷ(L kR-2vG Q2_; n[hyvC3y*jԔduJsḋ<1qNT3GPH _5ϢxoBWdmz߈3ڴr33Gaq5O<{k)R?w+_y|q™/R Sj*+O= o-ʷ{}o GT/ `k¾"Lm.bܼ>E|ɭxY s<ч7yq#N _3Ğ39.S5N t?'vz>}{ŗ3^$oinmwƿ`hLo۹\~.4~he%]\WxKF/;QW9nq]13_'Mfr\{_gDi*.7D|ϖm|Oq2. ?گؚtq~4+_9|8oQcV$U۔^Om%";Q}k|<femvDbPJwGj|5bGW|DVfaeXUVR\m+u?cIGQF`g=+ô۽OP_/lo!b}ϛ]"x7"<<~.k,K{:WW$:oV=aG~_w5ܣҬI'߶?|=zQ5(]jcǖ1_="36YJ5Q/p*HהuZ݊[SZ;2%~kǕ8-Si}G%޸lې1ɭ-?OծӠ蝫 sIhڤAsѲqGZQWW¸!RR#ߥ4lOЄU1,̄?΀dKe⩭tWφNϗLt?Qխ/!wĒ09*U(Ju] G1][GyM~) OQFq($,[hu~NuOѴ%6_xIZկ$+,z*_w@9[X:iN8Y1_Μg q:T̫ak8QAMXsi<?d8f}pk迆mѫH̰wc+w^ Funb%:Kr|HѴymV4fTk a8׏֮iΑyf0p sNzتغ"Ty5eV-JU'~y_{i _9XRqm^{[v{2Ǩ>0`9R:W^zƗmrbs͘w~d׹xLFIדC_MB9_b1!^b'(N:p/6͟~7gĝgKD $ ̾fvIڟ* T*x_ LѾ!ig2,;.&.9 U۫skiko&;|y8ڥV;JïM% qo>Ǫ*${IMHy Ak^u{RMy"j qR{HFksU$?<*y:G $q\0?J6Y<Zfc&3+NkZt=RcܴEc+6WBPuӒlS\i+ͩ$70 MxGuK v;j {+mQi=νyy-Ƨvhkφ.4*۷?6zsZaRs x*tZлx4餖H:R_u|/(u;H^F"򛏚8УXʬH|ܟJ.J6,wVjYc1𴧄*.r'Mq+ ymO-/vߘ3Xcʆ yjshO]8Ε:tgSpY;=UסU7v4/$O8dL}Mqu6⑮]~5-ҌZRY^2NvG({iH\\e̍/뮥w(Q U#>^x:) }N}qֺf4ԶnZ]?潗CPeUE 6w0\^M˗1?+=eO=Yt ЫtZ7Ķ*| NxLi!:kI̲8\$T2b YG5׭|F=w90T>*rNi>{m/eR#U1'>Zkq*d[KY5KH5³CzUfV{W|[7u+BN@[-][<0ە9ICNx[ukVI F$m@HzmVM\+)>uWRmKC[۬ln2|{ŵjڶ->Оbsm+a1Zyk]t?mb9m~Ҝ iZ}G -Famz YE6oyos*T;y{nk^ՠnmtg~~\1蔺c,mhHXhޕ:4ƢW^+3R|} Z$/-d啣+],pmǽ)^&Jum}y..mX3i)gdx5$wMy&c#ivu6淾"AHOSP̱o|>&9Pw~Ͷdn77 )[-ӞQYB 6"(OrDjO?_yJI-{+֕7ѝG/fגX>wݞ[,sTuկ K~5 =?זhI*y=q/_-mn^wG̛WES%ՅB-REY~8x8kF} PzcO7?3X {$zuʥ[A85_(O&EIt4r[>럲gįV|1O6 AzktYNZ~{zO4)˾y:ϰJ%?e)B?iΥw?>oյ]A#\L\c\>Dž-5{l.}yCVDy^BF j՛IM>`w8w=k)ƞ&myo}V*4-tK|+oEdm^P0wqz~Zo[ xƭi4{t3^ޣ$E"?47iiVz9YN;2E'|yOrg+Do51p?ޯcڷi6%<;=fd̒Yɰ*1Yx~m9K#<[G.&^Qr#^A<3i H Zgf$fNuNgY[ǵ/>s+ez}k}K; mk{]j O#}!UVG͛\D6Z Tv򸺵*b)ь/ g5ᎇ^2 JN1XY:^ij2{#])v1_G]0ZEjBcla[ھcZ1DPoU2|U#NzWK8\5L^.>iJ|?:>:=#fXd`6o[ēxV<#5Ưq#|;5 16Uf_oD>8ᇽ=REWYȳ־aMgW>7N+?p~x=K2 %Ɨ5ҪmgֿJ~~ex'.V*|GWVvIZjaHl`cھe/$7Rv>YGˏ@?J,k >i|M/y|?u0j%Iǚ1J[~!;}9[~s|OXէ- ;2/kNErv4[n_qCudjz,Msݷ^ 49b)^ iTWVwoK~8xg_s \8O̯G3[ut2/ݒP֙byG~`S-b~}̱3bjKӧ]b¿ ,<.osuumI`ms<F'A[_Zťֳrͼo$j4u_7ZtM֎x?zcsf'/*q|k_[yvLX2K9$]X+~X;Ǘk+j38ZU:Wrnrt=71c}RvDEm9⾧|GxO +[lLʑp-)`{A[7SB#Xj\+'' -vboNzws<8WluGkMu-%T_Y.W3yȬ_H6aČg+Cv:4{_b14q˞+7ZVtjvo>96g5x{-~Ùӡg𕵥̓[X`GMr ?jۋ.%a`xrbCTG⧇Z=Ћm0~8kLU15Nix\d}2JK_O]KQҴ)EZE&$>o5,Z4UaU%PXduxx'C_-Jӥ{-&6Hv)9*eMGWMlccl ,2~e+p#N%/y^˹t32^mjh^0CG17j4QH{`nuZ~[ۍ"exS)*IIi3[\=˘mdzu\49mm<)kI;~دhGX&u#nsg5cZ5ϝx NΥHoxK6$#"!_ |auK-g]yoV mV"|AnYȁ~kw#YZv+ }ҡ8%(k~G.Ju>jY-S_[Nt[綸eГuI`=R.|/5-,g)eYom⹲89?#ጯ#xjwVz~gYYJVM,_\T;1J@?LSNI_H|Ģ(I')l=)PEQ@Q@G?'5vQ"M;i*DgM{g<=3#)s1sb4ՅQGg­'uR7.TWfҡm޹+<"U7'mFR%>ie1O}l6~b(a1׿D74Oeeu{ĸXOI#UiOQ_Z 'M ~9XܺIa)Ɲx~sGJOHiCXzvCGc;ȳr/i{Z6UpدO x9_iI~6qLO¾9/j[ *J|>R>SxmPX*c/8oF"ZIuxļfq<4i)mm<]uF{wޱ;eG9rxc pI?1RBhъVhmZkukIOvd_0{m$$c~'6mh(n~dc33cWCmb`1֧tϜÎz#.FF:mV6m߭]ci[րcکIAr+P< ǿ8BуЊ袱ֵbR<pMhqNqlY8s^VIq[¡S6JqW-yXzpLX@pĀ9RCt|hXdAָ[al8Mm#pZ@#V󆥣q^qh}9 )\ӥyƯ8]T>#WFe,B¸[55􎫤nbB:`GF?3^KZ' vx\GT^89EBz[6TqYI=L39Զ< ~emˑq`>ԉ=:tϩ rpךՂc(NHNsZCr3k Dlgܯ=(㸭`8ҼVǫBv06i^/ ^EzǵnYDBg]`pr6AӢȯ*pѳF;uKU!p2Iz wZn8$zp]NM,j}~c?ʸM.=+4u 1ҼDKKeE㏥sCkt˛mbMhc>7G 92=;s"?]v1]Qso]rordg]-C0#'=k==ysLsIx\Ty8]󻞃ӧJbX[lNAN=E2#$wZ#Pe 8[qg [Q(Eo:ޯjG`@=G9մZe(r2#>V<]<=k,uZŴ̤8[dZ, +rq]D8u^?WL79j_6ݤn_I|4~4XRKxCZ8YI**k燸7-cډr}ۢR8мMcFEІHl+`i:JPEҒ(?ξѴRM2G$,Զ?,t8&?$g'wR_+aRKeViʮ#Ksk0is# Gt1TԢM\>lW˺.gzexetxw6cd i@2m8O Q3y mL3[>+ңW~7yvSC -8K1kgT8n'(ijւ;JrUOȼ|j7W46>lCBo>gˎnQED~MWsԆKѵe͌-:R) \UO|Kr95gV&GȀ ˏ{Kh$XO15*t(K'-19qBr㥾ܚhL KBq_Kk[ycnRBİ~{>߉|AVc#޿ֿY~ Zdsk ozll; ~*jbKϷQyp-W,VoҧFqm+1O^Y4|)kDZ\X4Sm@ڟΛV᥆7TּòhVJ"4̀9ƽ/oo2XrJm^0 ^i)ܰ~pxz<):9#g9wvΟ MgRU8dU3+<+6Lal݈CuY MaiW2y6.s)/7e^5UM<,ˌ U֌ߩkGqw/O&1\؊s,ӻ唜{?^ j 2öR][]M@8_>$/|3]4mm3BBILMUڎg>ujcͶGo1;w; oQY$#J%ÿxsLW ӌ`e]œ-%xuLg"}qR?>xB'׵(m-Ѷ4b@ <*Ǟ0-q${j/b&! Ols;->;$(0~+#N)6Er;jxUsj|SOׯMB/^^M\=A{[KJ=6/Zou}ZIMq*ٹ9_JmVWK%6H*J=W|u^Y,v5Jri O}p^[O44a'})kG57θCn)l| 8~|;)eum:3\{;kHҵ;-'VҬ*-mm˹Bi?Z?O-b C+۶pz3n$̒qҫC-e>Z_ {^0Y< re'{>g]Vw$][ZKP(bcp`TUmXVhNYW?{~!anaY~>gP5+KY{IdX_s{LF90̰Twm?_<<@\G .Jrro{tK?G}kCPH[\0J5LW^!]D_?ֿLk:/4=+5r2hہkM>a 50e-ʻʿsR.':ን4%?e6fI f[¸501^vRFOJv<]r0ⰢDd-q]}65JmÄ>خ[lw4X#|HAOq k3ު9/<(?+Wτ|*4S:H8ٹ~Sݦk>[c3[nl=./)J\{|~b0?TD}KKۏK!p9y½3_+O[288,GaTn5oo.g,Pdg⳼m=Y4 rc̑>E޿&^e %2^#TiS%(@ý:rrͻuǰ2ܬUbd#U<2C3~Wl5Inp)kc-~)*n1Mejt=[ukZ/uDTb{` .ߔ}[qYBvFs[/͎;zn}hzpʺMRb1 2\ppk|W]Iߙ{i$[wο8,È֧Sڣ.T#Re>N]^kW=\-ޣf[Xq6J?t7V"t$fo^I'z>ֳA|UmqX%J%"U)J-O%K9&tj`j3ܳ.&|^v+jLw6ek ¹˧K FPÈn}b{:XH'1׭hECC{' =<:-rFA :ȹ=kN/:&[(#hUW9zWg>L]B }Rb6795vk+%ZI#z`s[1|> WKYdIsToSG_W3$VX)0Ҽ ft6Ono.[]@&߃k/+6,<#O#rX%kcu0srJ_WGIS>gx]"kVP\iBNfiWRVPʮ2U"5KGTҜ'9y']碥 єt<^L +iMskPƥm-d"at;gC͜E}>]G)ѩ/_x8t)TK2h2̜IG+wӼM%%9URQr: R+EF8?Z*U].X\py/'Kd;H]1\c[K獘H+l|qbfk{T&l~Pʲu+oMǙ>q[)Ԇe[qN_r]9o}WVt`!ˆúrەܴ>h#㶝9U|%k)dyX\C %)#n3f>?k~Y]B9˗ u%iy~R}GAilKZZʹA|;[blIiJ ;}ww <'Mo[Ҿ!iu:jiy7Kh?ZIn(/V;U?7R ]e*bH}ԝ<$}HWW5]vVS'A3H.CEqʪ;ҿ,~.xsDm,jLp0}ᓿP5cYY1v[&|ړZv󆌟~o~d³4_|I[ևk][2[7q@KWarhũ$o'f4jW\u{?IG_B!^gH_-yh81$S O⮟ I܉خ2'yg^D:󪟐txj5;[>(?X$QF%{QksXxCIeP"o ̭! ҳNNk2IDSpҔ`ܓ:W*'h>GcWVյcvnjqs 1IL<+jbF.2IyX3/1_+o]S_xoV/clg1qȰ^Hgk|]'J4-F+G\ŷ.8x=zl{_Ҧm!<=xCD |O.K.YwNLSORUܭ?fʘlN6M?.+iOLݵM+MmcjR$ ҟMAIek`VV]IVeΛx#K ZՃ[2NI}QH3 4ԼN+c|j18ɻokV|9ƕme;SL% /أV >4k:[/"`{4X5)n#8 6m.P v!Y.L{vEx8z%)A.iyޟ$!Rp4k+BkraKˍ i!W"Bfuq$GDI b-ּg%ny lf$_xl3hm޼>wTcu䩂ԥ֝:}/Uk/C^+w>4!uڻ\|M6ex@ B85m +_IM,HO p`_ǐk;K,q_K+c?+r};~UkE+/&>W NS^okĚw5k]**h0.A`ɷ<_j1u2iҕ(+Sǎn5E]$[9lyiׅ^aidY.X!f-. ҋUkyc z+oRE-J?q!8fvvH=* >oɮ#xt& ˘hh՚6GLW~/ޡXK_["+n~8澳*UB?菘ͳ x(JiY.N^nk(C2=a5pxzPLXv̪q_C@rw1_e/W fn'E A1Amα#a*Od 'Jo*K|8dGw2%WI\)Xy+۷yO$}NHR/ci6qԵrJ-WTO>i&Pt X#vai3^W׼=%4&9KD #CNXҧa(?ѳ嵵]tQۀ`TTVo^xwP]JhbYcܻoҾǖm.4r2.q^R~οZ]?S k5KJrmo/Ï^u|G߀|p4Ju/.3 tc=iQN\ӷk;ߊzNHL|?ܧnSj^lloE$,6~~;jw+ÚƓ$j6CeSYpGC?Ogh-VY˩ Cs_L.YR8,uDܭtn~ S\t|o⏇t =p4/7n&σ|Cx%Kb*S3k?֤*c2Fq_/_co5źCJAɺ5$ yw)S˫[ ?ևqD|f%{Zoe V|9-B̳Apm$w)|Cu xht1gr&hqZyͳ̈w{+}`1,W#Oץ~[ br{o{PGN,4V>/ti| y#Fn'EdS-=Euo)?.<:!qu=*mTK,"bq~FwT/o[~%i<;kF|da%n[Y.-TCneH_=[Xev!ךߵE֍gef|!݊ 7ҭ]\$?4nO;9W0 =M?ş9:s~6xH$jm2B'9%_ZJ(zRS M'= %'/lAwGSs5HO}z1K$˳?,ZW]FD#Ά>3Yե sڍYQ@NFTdaHK{>WMlIۉ%EWRʿ)U!.bHg85njp\ |RB3_1l.2.2U30C[(-qAIF?xV9ouQfHR#:%.<]5{XYU~j@S$52 Qu]y8MZɟY HdR\ml<<[1> 9܇mG$ OA/#7!~"jѳ0 nk!p:J@ 9Zp_ ag)`y~.ԫ&ӎ2G'dnxoN:T+dCq5 =.)ƛ"QV8qZ3y.3{v)4S&=Ms7JKpEt7R)=kS^+;Z }F1\1$ d@s@[)ids8g-} aGW5q#Zn 峟Qr X63hijO.9ş+[rK9L-r[YlQOrhX8:U6ֺ sJշ̙GJNmw9{lCbrNA QڷF9_h-P}J-< W?y aF{u GRgxkNR^nQpGvՖ1{1I (ag& ` r >$D:Tۣg2l"PeĠ{j~mReu+FX4nKC ]Oc y$粟[ˈxʱV触0VZ- d`q/t(tgv8wWSv>yqNW4)F/"{ݔW5 Pdʅ$kE{ \Mn20z?Rk{eHwgo)k86ژ̫ F{2ާ%-M ~[# `[6RZҨs X$:D6hۻ5^m-n${q1nERGݫ(a~bg"p=LÆ1\<_zW_}_`e2m/,6~|WO|MKi[|l&5ܻWm?/ޑ4=+" w ¿Z_ &Dx |5\lW{3\QU˸~TiGN4jWG[_cÿWht0 ܸ*+x'AV{8S"1۴ҿOsIq{f7ݑBFX?c<-c:2nbmǃ:{c XqRE|^_3Cx/f0g.ZT.?Bo30.U*_x[W?ڮx߱׍tK%ӯ3wCtڿxxalsiH_/p3B*U*Sc&oG3c?yuMn, \'"VEo䦽fh/Qb)YS)K|;- Jm#_JT,Q&=%FrJգ) \||A'ص=(Hmey oi6䝵?>4þiȫpw,uxYOuԫ .ZWChVX JF>aCc๎[_*1X5Ri]J/=.ȮfEZ]\_4Sb4qA띤f>!.Cղ$v.% wUҾ$cLƟF)vRa1o"k^5VycL]A>R2 sRCRokԷ?>-71w 1ѷo |ݫx;Q8Jee?" }}wĞIK6i1KH'|=mu?K$V$ )s%rUi^g*U4t_ΘS(ʝT8ṯB|9qYt]/[vXJ-gzm<(\~խodI'R$- XCNӯJ3QU'{xG@5a-!Ӥ{޿NK <;w_u3qX,brz޾ i/m%b|Bjx_?| M+:̷ZfSͳXl,⿯Ş,w~#-|ouuFt/$ 6s^S_~x 9'.k+{K{kZv9r-vҼKt\('?195uc%kk&eM[ܺeʶGr/]EVOUŔ1{GW^L^7$<s*ҧO-6S٠mn[;_Z]]Z_n6,sv5;y%s!lUkR]Gb[ęn9LE:zBMSoR<\mRdolhs闢ymK&hgDwTIy%-^ II¶=;TiZFc95Ipp? \K)>7g݃+۫\&"J..ާMSxϕm__bժKs/s=+·e2CPgaS.<Ҽ[mJcL8O5;ҧ{[^/W*tzUkw-'4nruӀǭ=,]KB8oi'"UXcPĪ_էRΑ79ӑ-G[4k#Kqp#]T$ cm-^Tf{iْK{)x9%VcL/e.9h/7$+UzSIfaW>mnkʹo\{GEf˛{V=s{ eEt^IƳWĐ7LMbYy~nk5VS'|=.[/?sn̼:1+QSQKTԖObܓ:FC.Y? yiea17QG`bw+-[b;+c5oBCw/nٚXi+Y6y<zx{9/ 艡XZi_^iPq r>(Յ֣k6W䏕>luϽv.gNOftRkT9/Zk 2%`m6;}ZWMo漺6@壷ߺ܊a+[WC";OR#k[E~ʞ2[AK[[ %xߌ_?[1/O5+n[ی֯zw xvڄvpjBw\,Hʿ]O_Og5h&{ ;5vy#dWfIկ[=ϧJ4{(˫W 6lgc Ϧvҿnd X| joH'+Weޡod渴s"+ΩF+hX14~d!~5i,5Xy~kE;)e4*߻k?<]w]A>X`֜$[7ipq_*<Gild'>gʭz'gtOI=Zy[#VS,_ =?QMS7m w*1c: uj.U'mi6ϓxYMiq>o|,-<^}$DbyZcfo$Fg^1 丷%ym~x_'Ѵ}>(_{,"yѺ҅WƸqa<=OgGm>)[X5jwtz_~ h:f&Zۯ4~T j񥖉_& o hj!/Ҿ, hɊzWo[_< TݥvUҬG+) =E|7 Uu&ۿK->}OS zx!(ܞ)-}/w.oKu7  x+{ g}'[v/|W,W+Ynmn̓a/#k %rvS7ƫĪ_a.ȆTBGCS,M*(SWDzU11"-l@yOW~7~k+'{#V2Hۛ_jc:_#6ZH aZĺkt[TmnU.fgWS!\~K_YQF T]קCǾ i|𕼶R{g.˥dgo_^%yosxWIhEH_~FѦk7Yc GBEdR_"2f(V9e zWƔ3Kލ6EƵ<Y*~?UzR3Az<gހ9' sF/8G'E`I_Ne ~MU6ϥ*@hs0dwjFp Tz a$43ӷqIE/#>J2>P^&I@F1=qIEQEQEQK4Q@ 1xtZ?ye70\g]o=HVVHK,m0L.YWO]eʒ vxʌΒ*I EQ!NO[1tֶ)ȩ$@ d⳦\0׎L82I#Zc%:[+}kNq3]|/n뜺wvfdwU.I Wj \EAL,sz\6a\rkٯqm*u Lʂ{qZFMnsV<3RUp׺`%Lp$Oҹ)BA¯X%'wfvu?ݬtzX?:Öï:#ZGL4[}PmY+O\d*҆=Tg* Âȓg5kbF2;mZ8kf }?UV}Q1v+R QVـ:VGN1Ԋ支kM-|{ѷE!O3V∌}sj.h`X+Yt1.Eux HvVziWAN)AN%4Ҹ;Iic!O\pF'ҡ:s((ri _qJ}.FARyvlXmMz\X2V]͑ r;ZNl! ߌ 3}crko,qJm2H#c]lx >vn3f:Y=qһ#Ϩn.NݣIf0E~yC#'䙛h_͉xnc$g9/ ^hƱs4]ps!oz;^gK,db(?y<5X ,[~Ι,|+SVC+Hp_5[F敗cys˖pqQqesTUOܖV8M/"Λg $L6Bך›/b{5f ^Yﷷ$[f᳟ƾ݋vz 4*ʫy_0\p ٞ61rq䕟,UwSJe&ohozJfV+ω6;=+z;+w`_Xl3S2PMJ3ʧ}{8'(I|[+ZQԾؐFW1^æۤjNGWi+ fwR\lPc$m~58wsҡQM_\63 ׋nFncF]ne_ ^؜0O>?m`m'I[|fܱ;G"K|}:=SJUB)hwP_%.i {{ } ;Wisoxk4Ǐ6V~WX7m= #p;V|oA=ho[^>> 7, Q:ZJXW콟][vjPx[Y╏Ε:ҋznڨnNso-[Klex?Ck/\eAjwk2ۃ**CZ4%govXbqayfs^U:KX[!E ŭV>?sV̲~-&Þ_>2jGix2\\,RKw|E}7ύKo]k ] h{|旎|xOGOBw;to~#!CG.N<~iS>e|C1b׃r/{0xƹ.O Y#RܷN!qxw:mغbTnLϿ4כ._>ZtW O͚e >,#Wuٷ9xOú]*hʟ3¼N&1\M HJѦrzKs4NCW;,}d~gt;W6kJ/Q]oM"TxM6i,ي!1(qcou)ʝfGZdv!*xŖY aa~w'I_1M?7"nHZHU`'h[$*UzDD.B9mՐ,޻ @m1 tWv+Cf&y?+^~kWUU/ڽ>,Fon:5.h}|YN2Ђ嶲Zv&<'q#^\wi;Q« iNRDR dxʸn -Zhn}t{H =IMu}8'h*tfK$|%(q:d}viqa|ȏ n5[P}%D rZ?뚉4[gnѢq>3k_i7"5Hy+ּta-cMIΞݏ3{Z\*yB؍LX=+=3Őֿ|@ ֳQKkER~͖c?n|G{cw=mol1]."r6E#Lk*gS5/1 K?L C,sFXd~#xpuŐyyaræq^e8Җ&^ޢTW/,8xХiv_ ^8OjZ֣ "y{]|1X_K3<N]9^~>)kw*+$qbǕ&E_};zglaԭTb$ː~~u35Eno5 G \vjm4WVFBG|%?߁/^[)jL`46vµug|Gւ Kxڡ VWnMZgFMWq?~WFܒU?[N/ȴ{={\rŬr>_"S[(dX_syHD*qyUWzk'íB nkvEn꣍Nec߾QvH-gê:[^4ZK$f;i_؛JAUe@[De1瀫¼ge 6`Lfg򅗆A=A~eyt᳜2x4^#B:>z۱|xCV)Lk_]<Ŝu_|=um:KI7͟Êtf$tm?K]/rDf,q_ }-q8*E}"/ ZK/0̾UC6Ƅ9b.gMSI;˺nc)!IrŜ dFŔpߞk;:s=:x̜κ(R;qpai06 NZ}E̛X!r1Nk_3w{kn,)V56WZ7!+ lž行2YMu7>!i=cvwp.20F+`uuv~&xePιw$v { ŕO/u>S,a l4S_eǯ֋>.f+[ǒw60fJ-maB9Hdg'k}OiSTF;8bX:=? GfI@ݫ6nZXV41'L~\r[̪m.zINե6.w^z=xMTms85=>54Eq:KXٶ2H+B4Z&n)۸f=kc.hş.eqHGgKe_~G|X> þ>&hQ3,QI+g5>-￵ttK]qH|7K]{CnsͩZr&K \mX frb Kco75N~%jIM\F*wamFRV|-Yv[9`تҏ▩BQwW37㎉?[%a&^c\WJ>$mV]—Si~ @jW7F&Ue8"tk/Pk!,eԚa~i=|E /xDiNrڼI/NJgxLeź6_kyC8'y~_x{]񷋮ETupaV/t;.ĠDڣwqn`dkkXZ%Қ_vvso/-Ӿv; BR5ߴ\mcLLTOK%m]^xö~=帍|[,v jgX-~ܖ6ko^6d&Rr2֝}6u4mεeq6.>L`P0O?Z/o~In-HfWPSgi\VR\?wM?3䭘8Ӈ,kk'))5o*?*Wx94ϧu Rf?Hs_H Ӄ˃$$rmʹ~uֿ,a^_L7Lq+Olaqn_eqЎs[K;><5^_FYF֏ٍ_v}GE J$bKvd<#!x_@[p{P8)#WIZo:hӝu 22|6u~W?ZIῄZ,ǨMqK[kvV烞F8]҄pP<Ҕ[x9P*8(j*)8=W-*њ"E4t["ų˪$1+vYH9_glDe L++Oq*B62_媽*N)Z.l$ vmvuK[MA,7W=6'w#?W~\B*#G-yE w|!:w?dV_~0\xg,KvI+ݯ]s7WF > ׋uX;o2ce_OPS(۞V}R-χj^W4Z{ljx_BkywZNxZݤV#ppR~f~w4CF/W1!^ -!¾׭<+,. oH6o#_W-͵&.;|VdT GI?1J>얾oKl?GR]UF^cx{Zx~{>}(hlw2vZؽxVemԮCbۤkcyuAK=m%͝n2+_A_a*xZq]F2\;;ڞfYSsO3v|A2M*T~j4 q]ouOxVsK]*k/gL#]85N"]+G6ztE96 >c)I$ OdXM ݁}CKK1_Qw_'MZ+<ygӗϿCxT)2#/ldu & ]\,U ޸?Z,xcñ?dvwvU險$ڪKuvнֽ,ֶ>N,yV~܈岖YN5*|;ճov7gz![뗆2x\620+n[&Ɠ#,^pt/k _xf-mMr&ֵ*=4Q2J"1Bk7x Nk9:w]S=HesZ42)sr?L@07wu3y|#mq{5oC|cў Ϳh¿ЇS!6S!T yB<7c_cno_ͣ^9\fFl7#%xK _ǖ^+^Q+k8n7KZW9^އuQ_(b;Q@s\GJ`$t@ VQR<~)=QE(>viPJ9>lL8Nc#zяc J3fN?lgG"=1Z 89 VG麉뷰˖8'V>\{z鬵BcO?5O["V+;Jr89]<O ^5jw>YjEׂ7NЪx+ǯ꣜=Zͷ=j9)(i{$;=t2NJ޹@ ab; ՙ#NN}kz]rpA\'=*/mv\dbgE]cϽrq1,:ɡa(]\ n,+=۸GW,>35mܐO泔w<ǃc>9P ;Vk|ۚJ[YM`.ǧt쒤c:i̘ {[vD"׊ӏO 2o`8^[R8?LVNn[F9ų+sR m80yt?f#[c$fm4G<9MEH\gkSҬ,=7AUtQXp/9 8[;yiټv:rs vVnx5ِ»;ʹBb'#δՉ=H5nb7Z*sVsh-G p>Yq® ׶NsY{>]=$D$sFR:ZASs'4{7k^9U䘨ajY㏾@eq %vFsךf|n3r:Vd{|֑syKczTQ1cO+q<<$#L`sֵٝ2sWorq8/9]'=3AZ"q8WrY.AԃҴ!==4OMg€y$s^+Iub0Z̺pFjO4-V\I銟$ ^xMo i%ep3֪ E97i;ݒE,Gzt2d⦖@*7:^i%=3ȝH'jwbs9ݞ{{&A4Ghs-k !^?1Ԇs&RÇNc8b ?A[v%9݇9V)E&dXjڶ\FGlF+v7Pr8摲m<y`n |tnـ3-kEjx$=3i.6OTo`'9=/fXEؖ$OVՃ`+ckdqYW1%̏(Jo0sH`#>EwRY]OO'sqןvk@uʾq&8,_=X] ].Ս!$?_ [ۀ

u#!Zf9+uT.4eK\?AT+plʅe;s9-5[GI.0b-}__xSc/{6ǻn"Ӿ^Eq44 ϔG0n7` i?V-6y=_Yu*k7MEwݏ;$ b OjI**-vܥ^eK.|qs.qtA~1i*m(vڹTn!YVP T}EeV]3P.]7Cҿw+ʲ-Q ,lt߿)s=]W6bJmu[AE2|D5;A'ֹ KIG'jugH8ҾaWڟґlifԔ._Bi>[:WܕcOQUt98{m$fV5ֿ&R;%& = v_:Yi>$nm+ Xk hx;Tb7QkwFEǵ_GXTZ2IÝsZ{?>ΰ*CCI=ԕպ&_&_^$N \E~8?wּ|Gxwl) 7|U~ |#Uǃtu*.n>OV?DJZi=zMXcŎX/}ٶRZ>šB,~UߋXp~ .WVJSRVH9ncG]ԅd?f?)%{Wn-闚{tc_W^>9ᮍskntWnAl+4o@_ w=:]B/\mS¼?<4fktTGV(v1i|uѠ8iڵ8|啺שO^#+5*F1x:miC川!{m7ޏp]´s\\\i۲6#.\O5_& b~cxcr7OIFTJҲjclxj{Ov׽!m?[ѯlՑI 29kcŤ2y廌bYXAO Q"# .yo5sDz堳,.?)ܶOP 'xRͪ>i򿍸xƼRIm(˞1vXTי_ä/ HqJſ l&|%˂(d7]osSRvEch"*yc?x>(a>,l.[%#:pOA?c]dm1L5I32!V#Їe۔sӾkT)?`2L"(J~ϛS~Cu 5ئ"{e2W̤yE>_eRR]%n}BOTҊT_ٚtsӏli֫ ]g*x#,5dT };QN[m(z)F3Qzv"ֲc0g6-HuF,7N0+kjj;H/uL>2h'?6M2E.c+N7W'4Ni.lK3{@# @<*ncT&u%ϩɔ{E/KGAg%ӮpqV3}Z{5?Rmv4PR[n[#r+_ho.m22JX/ɜ_~~4υ>"ZqM ֓qJP+IkeEL]j(uyBpݹ_VX=#u?+hVQ4V6pM}xZI|lU4tVj1A 8 xOA7k>Y-"EIW(J<6[T+4;C#ڿ:HMFJʤou}/꧆S% W\~#Z\hAOX}"XQN}RПx~$|y[G#mE^2l<=7vD(.bB*,n}k>&?+b\rv&*N)Ǘ![:9i񍄫GhFsZs6 ?-v]uuf2?IU[_F6eě٘|+zd߷6 xcƿ >.J-ŀU chN: ϊ!WxvcVZo^UwӋMd&l x>D"g< Vߵy^%3QltMb}IomGڇj6}=6c2m^}ez̿O``1qzNpr:]{J:$^|͏0\g#׎~$P ]L3ùIHwGx^nCunτxVR'}9K{WOS :R[FQnGt}W/R!VVm4(\/#0w/kwGӍkNmF&I738־ҵzWmBz-#n%F?kIqk}Cz퍦!ܲeeU'WfxaWQ:Tod)h\(N8J/&ԝVv?01˭+>VK$VԺۦk#NMR֌i|n/nr;dIc8޵kf%mtT,܂} ~]C4^焼T񲏾__zg?oyr|xAqv8p=pq_T*YoSt 'te#66 [wP DѪȍ7W(^E7)~#l\}:T]?W`eR%OFmGq=Ɵ ]mEc߻/}/X,Q,[m|c9WY<6(nv_Nx-`nA7˻|g{սO+p?w_cD79q7,aڻ5m%UYnygt8 ȕ@;zzW|o\{HZSm.[u85_֗v۳&@=\VIk)mQ+د1QhFWu9d,}aYאvxvI?(Fk}U_6IWyL,FFH~a<7'xG~­g:ͧ<9x<1?eB\49`@6fwLluyImww`WW'j6B>%fhuH`p3:̓_yc]}|Coc>4L5gtq&qT]{ץ9ȩ:2qZ[G+|KsCϋg~1Hu%,Q7",.u}JZ4|L/JKcڅܮ&mN9Ӗo."d$卛y籯ΰypoIGU{^ޝu*d,mo 躦o!"fjW8|U]ç+EeoV<ȭ;^OVJ̙QJpl{NM$7nIa=Z!*jI4 _[Q|dw^<iuvH/ys+_;;6k+(8z>= W9d&yO+s]Ӽ1=meTpQQ^r`aa(<ʯ+V5؞fF78W5ys"lf*UkVF-R|*̬"FHujY&ҮݕXcE]:|51-K]=Orl,F.>>e)mf5RN'f_^>4x#šOuU ~oVa־fIᎃ4Dl-}FOۋ3nVs_VWtxZ)Jڤk*c6d)58ꯉx||s%Nqݲ̊/NkMb+ HL0?9G##'%oa-ڼjVGsmz_68Rԏ5^G*k[foYbԶ1AR:EPE~QEQE.;i5 ( )IcҒ Q}i(0h:nMQNݜqCҀg +< mAp~m0=o1]y=jӥ~Q˩ڑv9 }ִ`*>a Gq@'zbCpAz *ew{ox\)ߓճorINnm|Vv Mvm3krWk56Oҷ'^U3q${8+\^g<}klubyN[jA Ptӫfbq~k>i@{ tc{c=*ʭfzTI+]96R>;qӀ:-°A$}+5q;fE- 1rq~\GyC+*Xx>sL@Hmf#_z@=k&l~k[g[\8ӹK'5Qv :$} Flj9ٶreM<1~ºu`(:,Zd#=Wstr^j=%%99Y3Iw r6GZof?6IRmg=N+<*w1bz'zl{L)~-9O;{OnJ$(?^$sz8aGiv@yor2j-p9=+V+=ɬ\;;hA:Ҵ;FpG;jSdr55OGq8][kh>o_Wds*LYԋt/P{=➇gQ=)W.+Ƿ3Gݏ=V=)8*'M3M~ECOIl#78'nS|_^tȢ4v$A&O κ#qr-Я, (FZhOe^lT)OwZՆ$Ϗ,@3[^&q tW yxSn0N#Ꮚ5 n'TRvqUR'iJJ+1|KqהhS[d"hmmL;ĜuǭfZfy$/jξ(k䵣^4*xxݓȱ&"/ΤS\sh6?ׄ\ .mS/-+u<AU6).0Q]\ x a#?zuoLM7+ϬHo/U3'nZʷzE/"/>Xnsr~kF$ Pqq&xgLo–sGhħP9+WmkZJWkGSҼ}KQmg*.Y::3c)Γd#frS9g<0?ZaJ4xEGUeR^rR]2lY]adcMߐ%G}ֆ1rE7OMYcLo`k39Us:R3qkax gZVpKm>8&K;2܌yȫڗ%nl#UF9akjj5%FUXzǡgj v[^y4b]˶D}ꎍj^TtqkM;>Ml 'r1^.6eNZstCPU:ʴu]xHԤ+/JDykCAa⋔.1+2Py_6捬_ޛU6S}W} QNIqp%f[ay%pO1)ԴEV2IjzN|#*㪋 Mrz{kz +muXGuybEfX9z4ۨ[I!fnh.t; !u:@f%p=;>|V4FOA#+$!6}kcs?e+JO˲eN]??MW$ks-F5Ϛ?ڷM[]g[Y2kO#,v¾ҿhoxB[ VK&޻p9&SgoY&{k`3Dv6v| ^j7micy%m`gX8JU(RS^6(˕Wv;"Ζ# N2+ݾ{cxY|xt]+ؒ@hj62x֚"7wo?`Ovڢ[?2;@N+~xsQ׵ \{[i"VYFԑW>}q -WS-:wT?v+XžkyqXPxÖJIY.kiJwgot]MZ;B#YGMدDKwO'/ֽwsxAwrKW$[FU0&!te$^qm ڵ}&~[Zmt:8kO_~_/N'/dĜr!?\|_xœEUJ5#4|Nqqb^nm\[yWp_6dׇt;y5Xl]>ebNčĬv:jOP· ~UmXg3e$?:>(Z}.RJD/7|u~Z.$BK[YO;ץ}y\|24=n}QlfIihY!sHUp~)-4O~յKm~vIYf3" JU~Ga\ 'Bo|2Ӿ$ZF0uu(X»iq:7] Uυ~!7^5̬FcfpǼmmcڞC[ԧӞHF|xQ/zt\k2?YcBTXi!# p?vˡJ/z]ކ:u̚OQ~0$V[dXVa~x 6XuGxm9ksJ; ֓[h'-Ts*v~;|: ;|Z CZ. [9nެ)2)NNbm~bWN.X %~%[#M$UZ6Fz՝7Ě0}q۫+[MOR󲔎Fq|/uZ>og.+ r+#<7xBM" O"NXTFwZ//O}WO6,.,n?2kA·I:!$B==kw+}#[е qeд_w,tώǂ;xVj2Ŭec-l3j8*}u>sw :YȪ;cgiU#^g߳;!5Ֆ߱j37iok㉭mޑ q0ͿƼWm[8u*Ęlt<`?xsAcYIt dbB4i.ьy e^f>kp[͡*UXK>e}>]:| 5Xg$[')=If`=Ǟ t;6ȿ#@W67!`Q&wk|ŕ\U:0%3F@qںKOj_kw7n$C2?6@;W-Iwg21.H*2Z5+z/5d;gf*|Z-Rӥ|?ke]TV=rOäQj$#܋5͕nJ&ӆ 7ǃ>|/>x/\tm5kd;Q WysF_j,LJ"bYN<|@_*G_ĺk]Gr=F^HW^,żC4R+*`OҖoe%a12曒>%]#.5l>YSy+5Es{xWG񯆵mShAYmduYeTc`'": piM>dXna6O#' Z~ˑ//&zk'$a#T_ԟ|yoĶ~/En uY.rC_`pSHk?ԌhSq掛yxd}3r/:p|c+.soI('=~??h?/Z~ ^G.{gdGt˖9ٌ\]|O?f~9o,mqoGi.u:|0#8}/__xGP 3$cido9VCd/s<ե8˖t+}=ﶛrJfY͝f\>yRN/1P}jIݤ#дҴ{bR6u[-Sƿ?a$]Mi<ȯ-n9$`̛;mx@[xM/"Ko'=U +F[x>!F>(a `-mͯ,k.y ְ̨[2`%eU8,3sRO}=ˋ&|`Ʋ=ٴ*3#C,6>F,T)5[ȗauK1=J1̭;Q]n ?Q?;xw^$9r g]y޻#v#yLmɯF&wzGZ՝"5c_,xj(o7dVq_,SH,k@ź+pq}|ljUwD_C]# 9>=9]w羸ѵS*H_3$C@ {yǚqNFuXH;v:}T1+W.zneX:˛,C +9 qw6 ^+dF? ﶰY+m M3Bnu\֩ f|yfLI_s(se{cֵiR䓲%R7+4^[DpZeY}dƾJKIi'ͼHFCp_Xx!|3gq?} HU213oo=.;`Q_gUSmm޻qix 2ݬaty^ݙc $z)|_8| WZY"e9> h?O?[w/h>"Ov̓r>$[3LCJ߼mv߫j+G7CI~(/;|:|@'4e%ۃ*XGfpī0t<>jF6I%E!Wh|ptM[T}fm~7_a/|ǒU݆+.NSn= DO߼w:$Ul0;ev}Y9xZ7ӳkk>WLHkK1Ww}F\+Lj6 d6`OZR~ɦ\&"^«t^sLgSKf^[$;U $W >.$Wij+|ˑ>gϒFz++WvT\.c~~&oúɎm"Vb5~RYX7kJV< _ޛMȠ񈼱_ʿn[Z֟a8 jfۋc C=K-40ZK$|2( _E5nQsFQԛԔtR|%O .)JZ]ZI2A9C }'f9ZjFwq҉;s~ݬ;SPԘI!Vf]ͷy:=fl5 WuG_10mW^>c\T%zi]/[z :Vwm.#eyO#<cL4m6zLim3G,anmfTiQUc%G03oLծ4s4q&l݌q.㴲.{+(kO \vjߛr6 uf,[IR`aeՑFSE$)Σ6-84dRڢ<>fARhW3-E 'sF٨S/v6=^s_jÚNދɵQiU&Swc%~Kyr^?w]^'h ѭW_Sie@UXˊg;[ËgmJFѼ;<iUNy\#fהb[XK;Ƽ)1yJNCi_t :O[ЎL}iXW36aʏb_x@j9@籮y;hmMvE22Z,yN=*Gw9:zS rpq+f$$lk<9$1W,}cߞ 1*hNGV픞T\T Eld?JYqɮ+fm8$Rm-hnxǸɨ%S+AAVsӎF1YyY=wT{Cs+ %[>QUZ%nyt8$Z{/})- PE| Վ/b@K 8\XuS vmΎ.v'sVd#'?ʹRx|@^)]-Nd^:NJ02Nsz+Qݲ=$Й5{#aH q_N2k.{O&:2$gl+4{{?kB~k]=OZنeRlqY<k +2zdW+ qJt`:~5 pO`:=3W"j Do֬e[~E 1޵mrF{AY蛍w5!c!AbWd?8xʩk]ԣ3!+ O+aeQY8ٜsc5XT}m*%u+jF1#5WQ^FSx [0E"H[t?69{QiaiK)Gte޵=ֽ居 *ϸF@w~*ZDɑco@+irxwX 6;JȻ+< +QxI, J:}qZ? G K)ͯRV-Iͪ!)I[kퟲo[})͵w׊^6VQisc~XAElV)Bz`G?Em\p.0v95<Ҏ6ž(e2jiזsI7cOz9%v+jM?yu޹ww$p `eۿ8x#rh.\ yNjŢOp⍑_6VrOX[#UQ[,߸ymE'"Ozф4n,ۊڟ |&;iJ}yNkaԴ[z≮wK663^H|O ~+ɥZhno /?"mFJ?mw/'2 z<;ÒC]Eiҹ#b_-΃ƞ rO pHąs_%n8d/6NX.A$rnr~^ )q{AX:yq]A J*9.cirsJRR]ekS|Q`3o%nw1^ZV:/%:4v$ecGݏ#Ѯ}Mu Fd?S+&E}މyUQ N+;_ZfnUVhߔZ0өTJ8Jy$+]%|+W,Te Jiњۙ'Ÿ|eo⋛6_v=^W|jFY&W#b" p]$ Y'Oz Whl2"}l.|9IԒ1^)Cnг:7??'zb!s؉-K+d~V5 ss x\g-]ЪU _tkmk'ar-!7}<+Oiԇl,ҽk#Hnsy}3ͺ$< ZέaZ0٫}硕cpuלiժzY|iŶ6JWM,zB͂y7_,|aԵFo>GUi<ݤ~կ>4lae,%m8ey݈`WN* q[;he8ZPT {k ҭ|AIshAyi18]x޿}jK%Y71)>,~|z;e~~8LePU?t5~A_N.KErmw< C ˹y2 uGZ+VFu 1%sO>kgJ5#(ۡ5ǟM{.on/"ɵck>v:6}_ka77mP޵}GF]"I !WGc|o=xw\$M{ OObv۞k3W[ejq~kK-f ̻/o_;[>?5 :C3H48V.cQҾFt~ҰMt/[pk+W쓭ߵwi¯xUԓiy)\0T_#hpg д>Y{;_OH>7e50эF]ܺ|"6/`]I.V^\]74YGLyC>Ճ\ksh]3Q{rM\W@?vѴi" ڂaZu wBsM,|J~tiBB@ڻ`\䛩MeOIf<9~\ ⧥I>u-~ٟmw_|5i:RH:r^ۇfcIn yhK>,t2@A ~,İ-׍Þ߅|yB&vTP ;:}^m_QZwlTl< S$i SJ6km5Jv>eh/_B)Wy\(oB4)jvېqߵ|eoDWWp|g޽#Eg{\j0e^zw*7Jw?ҞC(moj=]ܭ5$hԺwɯM~HfeXnd9X.Ϻ5e&X_Yv{DH!Y|{ӵzWV6r&/("L>5:<xJ]2Fs.#u<ʊ1k*s>V^Ua^]=.8Y FD sG_Iwww#0ٖ Vu#o??flGe'݆Ѵբ WlsZ֬.eGopW2I"΋}O}-m>֖5+ճk5&"'Ey}*qV_n_XnX.(OIJ2sZߊ| q }ѕsR°ȲQ]uw1^g4mr$Ffګz⼟Ė^'&xm?Phk!wnVDFI8 k5.xd/O#*RS.myrpӹW8 _=Pޭ#2D b3y!A<^=k-H7LFܗ Ӕ?4cEySh_~_oo4ge 3oaiէV]Uk>#EԿ w֋d@f]#c_GLL|e[~~|E;7K]z%nH, ىAǚ `JOrqg;]hI1חm3o.㕴KHiLFLZ1lu+Ko> u}k[:mh '*GK#qze+?<oGINCc޿<wě; 7v|^oiskb1aWcB<)Q4ݣ򲻱r#֔(:1^ꌓX~.XsΓB6ht5u@(I6#0]`ua{?/oݙMm|/H kb" |5@k⽮+V t]-^f'Sx-n^ZqkiZQm^S4;64il.zdZAZ {fGjZﴢk :OV4xh替"}94-!̗i1 5|'\\n[Vn1GZro.H|7aXšh.m9%>mjMGml"lGU?*HǵaƖDi~w?XO||Sr<:t3)Rsyq^]fVWMz[~S׫&Z_z6QsT97hK%|E:k46J];HsfȠQ_=>|?|Σ֭aP"5x+7?k? k>"fsn[ɺ\7j8tK_l'HɺH!mH6 Nhꮬ^ 8as)1Xڑj=oJTr){gפzUY=m­TKKXl)yc#NDNu662 f*[;qT>Z<\L[аB^AQf9uXԌ'\o=5+ VJeo.E#^kZ "Gn 19)ʑS0:Js6qқ@Q@<}uQ@MQ@Q@ zRQERϥ(秵6((O\S:Msz eQ@Q@Q@Q@Q@vWxAڸ4sws)[ոxkF#R0$=7dsu#7a0KQ5p0O OfAY3e]ltvpOTm lZ=a.ߥ.F?icѡԀ<8^5PxW8q_lkVPa>Mo`dz淭L2}^R!q99ϥt;qnTj]{1ԟu6z=sׯI yz5p7>eNg {֝.EpHA܆\I;($@8VN{ŶzZ>x]OB,sܟqȹy@F?=Fr3a:2:g1֭{HbL*'[VЂ`f6 =?Jtt`PQӑLh<ǧ".35*8z ?7=7[>]!O M>`{c{kϨ.p+^BXcU569κ [:l^IooZrs\f4h/ixs^kkc-9<5G R[n$태~ *Ct8ZX5 ;Ǯ7VݾlZw5; 8v;NX79=3W# ddp'vkrw * Q i.c= 9[#9K~B 9`W=vw֮><-`[ɜӥpH8=:Wcxdp+N<_Z^;T}ϗh\x/5G%|E`9ǥ~R'Oi.o/?_?u2qtELdY3~j|!mZȑPg\x.xJ9ve9,_(IKk+]wKm-^T9^UCטiSkN2KbŰW_GŬYGBsɏ SÚ]WJΧpfMar<=Zx{)A[3yV9N2Z뵎Z.DAZTy54Cmzb w"- {Xjmڝ:SݲQ`W(.KCV>aRhNZF.K+"J10X 5_OV-g%ຎih֑~__0{Lpa?_/F<JdM0q,+*؟+?~%+ԭSsޏm~O){[B6Jձ$bP OZhd2l2y* #qXvR;8L'Bz,4"[pw2I8JHpX ۖ<:dQqj:`?ZZ~$Uq 3Q]cW˾>Y5cKWΥrˇGqZ.רB6n|Nx/OiZ\ YXo]nLW4P62P 3k{ 4bi d=}+&aqsÈrh;I_RbEJJrʯ7,QbsQfBϴ)>xg@[gCVE^s_ u#ľ>i[kq2&i$e~k4Qbl*oԛdmֿC>xU"`yeP#]->_JGKc65jtNMy3s2|2oO[[_ rKo$a_3hew_P(Н XIۘ~Oz]<RtX3'4Lqh~$|"]^xkSia&۴{1ݾ~g;YEQ^/bu&xw^).B\0ʆi0=3_~𷀾)xIuV>BG!ʖ;fEg"sx"캵6acr ?~|T>2>"Y܉žo_Z5Z'qk#XyZ\K{in#.L=jRt}~LM/VڗuHck9ƫqm˸p;W??LXm9/fg``}kO/O|=c\ݮG5l"HG/x=g_$ҵBV*%·b}_^MԼ#igkos%ūF븩Rpyg?SNJڹd}׬~} OJXm0ʃw8*{kHJwa`c04q$)Ӝe-O\Rn8qB {zR  ռnG[Q{_9-,,|^4٤_&lz"ڳI bFǸ:o? '~Ŀ_=iƋp"X6k+C H#r ޢJf +Nb^?߅|U~ÿ |f^\ZM/Wmq$v|?/֯*ъ啭Ef2׹g)*<-zT~̭+j{iEx/]5 muYbUzIuMZ#RtSq}'9Ao4!qėB-O'aH ۸{w!ⶻ},~qe8~]l0SSlzKD]≾ӨjMDU1q'W+e;Ĥ 6zWڊIW 6x 3׍Yx?P׉.nc@5 ݬw /ZUZZߥ}״?<6|çv y- w\cE쌐bZ{ُO!Ԭ@/5YF'[YcUmm\.>nƻeevem췭{̧/cNr d7Qݦ{k4=AP[Gd`wWؗє&qk,ch>HK~훞^aDawy1Knٵ&44G-}w^V@6y<'1_$U+jYXiwRiŊkV|ɤ-~lg>;9_:$^9V]F]\?U´p~빗8xF -~ug Y$U3g|PFM|-;oQ^ʽ<.c #Qnv`u\Aα|jHzFOu9UU5Cb$i"$-V3?3Ovۥs<{'ɐT|c_OZVSѧ*jJ;-k& ߔeݿkA,?"ym,6?_j`-dg%L) ^Zf GMϽ}36M_kiˤ{kg=.F:] ,rnϧARFsڷW4=3P~1.[;WoF.n&FGe q8߉/5ZŤܟ"x}bŽ+ 9)u?>|5!gz<'즤;[3cᗎg\)٢~W_i]DHDvU8zk~hAnwgJK0_+Eޫ{^k26,^ߠڑn¾77l6Z:#;6 Y\+]Mk[yK('֫"Rp?*@Ьjhc?wl}x5k=]/?E&w}SY3Xw:&5تpSkxxjO y|DQ]$ץxcQ /quqE"KBIwXNޟ)bKm*;>r9k|__J2m.'uTr-`!_0N*jo~_7}kcY崕=.ox;-s,dpb_w+Ү|Qy}?翽{4?6DW6[m 0$2*F}kU{Aqt,[kF;#ٕLL^'FK쮞_y>_)?ZO[h}7>+JE3]RB)u?r@~|BѮu$iw7C.+/%vx;߉uٴ]:6mv|ːTN.]r%yexR;qu*U#-e|ƼGq6>%87]mJ5o\ف A_]kNGu7{{MEvlt/y7yE]-tMF{xF/cӌՄp#]׽َ2^1kEﶧ!)5Xw^G;ʿ*vߥ}q/x?^_LkOTM1Ȋq\ U ZKnJ7Jvwo^aib;d۹⹱~0x W_=9u6XyE>U{ݸ7oOBHIҤkqq+I?񇊛"ԵrWLv yq޾Kze쌫 ³0cW¾4Zqie y-3j[b ZL\xxVZ.Y}.Sac_KͳOB\N:-7RPppF=vntWįVKbK |ҫ6Фcb?f|CL ↽C,:F]͓C_ ѵYm=*RGQQI5]xw+X o+a2{UMӴ} t$)ݟ7}JWC8t޲2˩3\9cs}+!hZzu> u`1N4V^bhݥ1_޿sGen8Y#6.#M'Z㻫5R(s"awtKCX2wK̹rHztoNsYlwO\)ԩ]KWkeklKܪbFKvxr4=8ZEWwLg#v^Kt/(NWWGe--CkcyXXo8>\kv8ֽ)tZWQlsģZ>K[uf~šΣA2'-pwc]|1_. t;YK)#T%"*~=+3G6 iY>Xʍ[⦉ό4ɮ/dy. {W\Ack#rS]j4~_ ֩[dMGZKu%-ΊHuQwS595Z4Ѥ~݀a'0c_׍) ~gfϩSZO, ŐuV_ ?1𥴾|v p[=Xlp&fϗ-Wek>9f8Ip{*FO~XQ4QE~)Q@Q@Q@(>hIU#4 28IE.((:w:Ҁ# ~$zJ((i?(}?QE(8<QK%.8֒rh=(=O֒ ( ( ( ( 4qi_ Cj 緮$,fvlշ ʷ޼Q56Kq_⮪T9STstq_7KJ^'Z_.r7>sq[#5ЪvGacxUs^9g|A]һK ܕ$klS:~ Q~"ӯ8af6 dZz]#vX88\U=IҼګ=j2N'E v#jD>?{5n9ֵўbtsVj۷޲vzVų(?wz;l4לd9O;*{{bLaߥܓMN0}p$vϥu71{Yf{Ir]u'F%d8QүMcӨi$1qIݚA]5ጎڸv'ֺI37i_B,qOuz뻨~Xszu]6y8I-{ Tsԏ·`2;ֱ혮SmsJ;4_MKqԶ09A&R4A+OC)Mla'Q*dwk6AAǧz=##kԬ.p8ctg5m!mXpM`g]-]J9nrNUqҼS =Ե8a^__=1Zrjsg{89Ry\=zަ]q\UړtG |=8=kf 9ZԺ<+F  t 'ʯ uC|p1㊿?Œ;'gfp l.=In,m|dR˸/|=}$ْc'|Σ?Z/ifu6_31J:^=9z5}ًv^ iQ*6Wfgpq]\גHNlXa+S(dَi\G,aiGGsڼyV;kKc_T0;M Uд SEt;)1^36ZiZ\ *.Lj&!ֽl,@F+Km:u2-`lMJrq~{/8>Ꙥ-YZnMz(o ͠C.Uo,/%` =|[#A[;{pm?2Yh}-t 3Dl{]\޿8%W(^^4e:^6}8*9{g[Y%tⓨ,m9B9Vl̰~7Cc{B16]煭ⷎI+8|+|3*-E4=?-孍͵OpVbg8uM:S#ԗZlҖg-FDJ;8ݎ8l2Z%\v¢(?vIKD; J= Q(VF7 j\mYqx)uo  f+ݍĹfy+YKCfےXcim3%Ϩx!l>Zh@nrۆRъRlNs^NQ2LLdGJ[kOC229$㝼 #g4-{8XNKV8b((Y6v0If*{u6q%ȑ+zv9&}[;">18^83.+#D,(mk<}⤙mC͓3[JߥI/.~6ks/1㌅?Z#(ϰ!y-p{ B3g{ (^yLN*dL!HqL:,\6e-+r%rd/*K0җϣftဍ߯s| ~-J#;v?ֽ&/+1rNT|:mvF756ŮXJk~,1 E3~.eŞDoW:ᶊxl@JF~U$];WX4a96oO< WG+T 7$3lW_j;\4ϟJ7:13#7ͯEymݳ jRo-FfV] puEcup ,24aA$ Wukag}| muQ[BmHX z(zʣ~Nm=>ԩ›`SZ,JI}c'xrv1@8_jFYd=v G3F` >m,y=|2L^Wfp0YIW|g|3( EӨ%}WTZk8L5 ujbگ?+H4xr4exFC367ӯz86ҼWmwn:1B|TrrxٞE~3*Lj4TcV7[G"0}g`{qZ2A-c p:wiSc1X~U%˯ٿcr*|cmmeO'Í~)-=}{?2!A,|jӵ(TI$R0x}3JGՑ(m͎OWß2-$; Vl;~\{TSK|>]n 6|"n- +kj5i崚5iy\('NJT}Pdn4^u7ǨQksWZ}]J{eM`#VfNry=oW{4jGo۩ 4Yn&9YI]9GK4c112ɟҿ_ X;[#G/?3dtzλ'2("9;>_?^xUum4ac_rkQi8HL@HQ7,bϽ|^.,=udYZR\iⳲ|S|FO.,|0B4rH6rzvO@Եk?i qT۱G˃؏z?veH_I~?iw8jcxIC(0p6=k(Zߞ)qLN>{C}~ _oI$_S&X~_&9uf [?Eڗψ&;kie.ۗMÏ~6&eN-RGyvXx +tۃ2WƷ|_WAu+B!Xa!k `'Ru>wt}˖ԣ%wm}CAVGl`<u> }iի(uޮ_w|k[ ? -\v'ggO xMѯZخn1>6Z sƾOß1\GUVorCY z=qG qjB}\|Cai6WP](`3J\yL? RaxM).?C jQ*U#i'"%&fF^z^y.EK)N?.آ\VxZX¯S&`Kּ$jbB\VٖF}xI7MiiZޗ|$w06#e~":~7|u-o8fH㷒kxq%㪀1=/TzNka[\ tFf] ]S}fPkۧ4ٕOi'jf]^֢CM{FG&˿x 9#Wc-,jPAy#yq,x`, ♿k~ >N+iL~j$%IL,h^OJpYseiVwHJ&ɸ2~ƙ}l 7o{O%|)Pb\_/+iJ*Nu*$I/!LZגظ2"sz4XI ]~\]d͌ ׵~'=\TGl& T~jR_9l3/FNq^GiƋ|;cwNǥ}wfR(CWCŤ&CdjV0IwjɹURkʳЩwU6ITib fiEi;vg{V;]n,7aq߉7yGK@նr{q~~|aߊMCWföoq PD'dZwN[ɦ+ >29o7d¿XnFUqw\&qoC6ɫ`(˖,.Imn~MC_vh.";XXՖF_9wv穯|3rngGf6μ⭵΍;S,:DM18W) 78VB$Qw ?)j>/| zwO}G-uH Ku1qlhI^i l<,k-oz9!/ wuq2Mk*|\\sڹk[с~kh2d}UҔj$~brDf~g :7q^O2ebO2c~[ē6K 8;jyxn9ݚ/Fs[,Iʭ߯J |.\]uiI?ҷ߹MjMq>Q^Z} sC`&MZ٥RH1?JW(u sXmɖ1n ae2+{^bRwrv_z?>XφifZ9E )۬qv#ESP}|7COko\,;RP''si@T*>vs^~V_&_|IuRivϛspvnf _yS:\PRyE(CnWqfre%yRۤ_ se+ةiMCk1i4ZāJnkžk_H}N0FK[1q_rx:*5/% =qׅ4w'$kf3᝭Bψ,kPZ}O3)1q%[ IӬk ?z͞oSnEpso$i_ |GkGHF"u+Xq W*ĺh{koۭף9֫Q{y(kmQxNW~׭uѕ*wJOA_ߴCQ6GZH ,>N0W_gA{wX翥?_7wj.qq./20FS~nkU%|MV_'pW b0cʽ$N.<#k:ێ&QbFH~)kzwj ܔki!TFXW~55}gmsq~o%5[Vٕٱ,t_i(?TƱnh-X+g mc~y #64)x}:Ef`}O?_ ,3\η4euZo$׭q-vE"ozL=Ei̱}0uƕ)|'nI#]YUrsMz/t/jQš"1rA^.uj>wqӚs0Pllyh_Zu|RY巛Vk+`дb6n^?]:aaڗv34xQ`F 5c hU.ަ=|Waiukh&X88\cڜpY+K]N| kҊzG;}>4 }s9O)!H?ν{C'{{>,5+EsyVom?y߽Yٟ̿y=y9ҴwYl<)\.?Oۤ}+̛F2,<2J?kWgRycr9Sc^ (? ( ( ( (s@cJu緥88?.) 8.rri(~b>Ҕ8sҀ' =i$v= ?P1q6N3QJv02G_Sim.2}:LӘON((()A RQ@$01&@4 qGE((((J?_W]6ng!w8jز6;JK1pTۜc1BXrb8Mh{smǯҴ9 (gt V7pktUN% 8@\SqM'8d# .I<{m/X`n ro?78z~́{?c?Y;}@V̭WA{z5gxAR W=J-#&^UX]g9c6^O'oT;ʰkCVMѦ\|̙ ~?j:~һ.ќc2lzewvw9*4(~84 e'BsۥyuSdz(ϯ$\O^'_Z;:ieOZՌv}kw5 ONͣ%{Hy9l4bHS0d9j\Scs#Q(;H w ) 5M [lO:W1n28O򩿴 EpKl`d{˩0[Bܥ]zz8 ~fLqǡT?'I>QU#LV>גG7p 0zd~J[ |$?ʷmuּNUpZk- '{E-t=S';Ўo2tJWCd? [1j<РӰGk2>n xExt:~qlEQs_'pu-zmֵ$gk-לVq׽hF|:\U'#'^=7z |$sGPW=*MS9Ұrr99U> f\jSIQ.n}_=w[>qm(cB9 yGݭ}Z!ep\t] 4A ~~Ip;RiտxoC8.&<z9svW; ARgUNܦ#OI%EH©mχ/ZjډdiKIm{ͯ8*3gyFuC9]eVvn=v>p9*Fܺ]$_Ҵt"lRq^xuK<˄1y?/xÝM]E˲hyH0WːG+ I:Kq\.QQ/i^tbO#v oJMzw)]|pD8_yoi'Q0h)[W=O?0ٮ,6cg~]f3Rh&U߿PZEe$tRJ1m#9F-9{O8O~Msv+HI "uo ]_N# 唁d{{TyJ}5շi,Þܟgߩu=7e$-~c#|F1TaB[. ^s)eܞuO&N<*SԻfKfn3ݜxI:K˘<ȠbyXEF ɜ*ŜN[wͼjGChʕGwڽRּ-yn%vRNG-^w%ޡ4Fx1{熴7P|Ǎ7)<; * ynxҾOa*ΤWnK ewS)gmz7vג_4&%MկfU$WC;WacN3ҹ{cI6>~J΍ՒL2V4h-gYUGd:}YqNլ۽f4) }~Y滅Dx  Gr(So:98稾=tVl &ZX#Tc^G2SAn+_87D28ʴr*1WCiT86/J?J_Gh Vl_ry%ՄwJVgf!xFM \G*m9 |+b1.uj{;|LSz |wp` sޭ|Sx`A?¯"yPv [1. o _U.7su?أw>w ȫdb&#--VB-;SA57Vm8?z Z%$yְ- ;ž3~~'zxL*~KWGJ6|?,WD\"$n=w-'z]x#gܜWEWšީ$M8w'wX,r$ڱ5=vwc.95y:gp{`5RQˌ¢lbbGW|`|K i-bO/0?Mλ\,o Z2%L( bN"\ohrMHosrG'*^ΜnRv󵾵 a/?i8ѩ@|&7ž! .bm9O\JTtkCFuɺu.JWytnZIav*PL;7@XP78K^S[Z f2YgcpqҧܤrkEqe$Q2mb8jM ^a[X&j}~;_X30Hfsx VKh{BH Wӟ|E'~M ^KM>)(bn6~:ɳl5pU!(zAfW^GԄ֊dGA'?߰ˆ&B\7:vV#g? [~imx;R^ӭMfIc]\XM;f߲蠆I7+!)|Oq%wO>wZ5ydшV>3__g\'9Q)bGKIrq]4qxqQJ6EW?e_ |uoZh5B$vW5l!RW> ži>!ӡ\ֱlT\n8"xsN| ׾ jAxH"ͭ5*Bdo7W]w?~*x'fӵKt/6GqxyRU.hic#j?ʶ8o(5WכsCNxnքǵ^m+r2q_? &X[Uܒ*f:WW5iڄ76yQO}*+G㇄XjK&HU3z5k`^HѓGN4 c} |1񕱏TF~A'Wf5'MvZ:Z7rrnb+ׁ߅ i*~ڰ)XEtu4.='ٯG;SBU?Es=|gPnxD}o{7o: ]N_zg aynXmcޑ5ԋ݌ck1ˀY=SOW6Vܾ־KJsIſ[v>g ٭9b}w>5[_aԣO{gcp\n$U]9_}W'ZKqfy0/mNV_gG!enǾk=ӦIuy`b"q7x5Ӗ:9.ayFҝvW'.`tOIZW?ncKFоH""^Jz MΟ ,..>ՙ`%lW9e|Go$ IeV&oۗZ^]yM2$`#򯻕YL$]uӵΗ0M5eEi/ƛ?Ə XJ9{^C"MLʭ7<~w-]ogxZ;ln/b9$;>ðVoXx\miTɦ׻wneG#kfeM?Zin?klIT} kOPrm.׌X^nb7ѱV_,4q8*בb5SpRVekg}A,cܢs2 A]rP۱E֊o)iU&UV_q_M~͞:uiv:j:LvrZGueX|¾K2J9[U7O^ձ Ry[J*ϣ_\Gmuip<[q 8^TeZ#D&P8;s|h:o/M׼/w%4b쯆hS76嬍/++2\?+/ھm.#lu5ek?(+hOmwq4L7;o0 :~ſ cE7G}n2HT pOz3]wS/mA#X]l GշĮծ8o.;c9Z.n|A{T:ڎY<ļY-Hx^1Ԯ?3t8FTA_GJ8jooD'ej)[_&~rJVI20*:mW1dȜk^9,odstd[>94YeG7xZ ژj 4WM$L2l>>3LRݬ-c"5҂Uz-cz6n$u.nTG"6>TwZ$.Uџ8iiI&}PgYfk CE_i 8Y?sor}?Piڭ^g:M`]92ylN=տ?ό?/~:֯mg|F.o5 5{YcXc*O̿}6*q,VcMŒa&۾^ߙL ahέLM=q^lv߱Qi> OgLrS4NPFuHm<7uq5΋q,i|ˍCocWs5Qk壽Ӧ79]aٹr22zWOK/e"202Mt"/%xRdx_?uMOTĐ~$ 2x' [p׵o>&4nBXltY8bUD@\џ|-]R/.mCOY jpq+}⿉47[hY!erx#+Щ*~ڬ\nֈOS4`ZJM*+ρ<AVxr,hH7!5@KWCzմ97c#ҦռKfR&X5 _P#tX~墼3,6c޿kוjGr,6Ul+B*y^hu٫]K)a<ϽsY8 V$XM1+p}CQ8s櫍yul*ٞvuQJ]E~ȿu_tOWasv?ziaow)H|廖{C~joy/J ׭嶚}2{:ў}7A팟jx ’*“}7*yWpqofSŜTޛ~\*K4MVq3OEUp7I]іx]IūGGYjӡ"Y9ڦXLGBUkU.? [-*#EK}칛O+/ϐ_nDuk;ϰn"C@L 01_jzoMrMº]žhX쿶7|Ŀ7V[eٌv~׾Y4XE,+kMrыKo/(9+"Gpxiu[Hkx*/'Ҡ-e y띹ھ)OjQJYwRN 8`F.X$daTW`3{ׇcg)wV=ܫL7?gm,i?zSX;.ߌuxY&m;ÖSm fJvWR7~^ y/.`($^Lsȭx_ j_jٟR[{$o`Q^5-x΍&g|?ux<5Q=a,Wa)˕u~o/ǿx\j/|)$S dV8ҿ,ۥVXч]j˵/ ZƇc∭..ۢz۫İY |G(_m+8_ļ#hR6?0W C *J)EW'PQEQEQERԁrzqOs@$c#u~@#:1IӺA ^F¨9-EƓz";ӈ۴m#u{9`Tª[i|`F􋖖)V9B7cE'R7^g\rt2iutXv&3&z=Rf'Gv{z3Cg5[c5ܠ|-+[-GH4Yf޴ VΣ[Jh/&11FicƲdMϏk34]8%N%i+17ݸ4d>ϭQdIKE81ϨEhLI('?80瞴( ~^8 %)qNxךsTP]X{PigjL$G/>r p +*^cx~]Q˼x u z{j2021Ұܤ}y[*GIJp{_#3X!g4?\&Ksw8[<1y9yyf&JE3ˌ8wmgҼVF98Ϯk~ 'y8-l{_^+5ۆo4=kؼaأ ZYKS1R-f\Jc$"E7vSz_ y1W#Ԁ\HC.O*t̹n=H?=JH󼃟Z AUH*C:fĞukʓR[ zO^ؽV!Xuq$W8lSסSU4{:N-esbW;^!:e\{ U=c>awWY“ry[\gv0p0j!w}*GO5.['ϧ9 u91 'V};5\M9KHޒ~i/Ě-\pU=v)_m#AkH ܠn;80$z5m(Xܮ׀[Ƙuyc(өJRٜ'ÍkĚ/uJj(ʹ:m"lcrxOu%̥W 1+XMYD<||ޕb;?/e/OY~Xc/׆<~uҊKYM!s[ !H(r=*$H2sYwr9͕ۜeЯ[ӥ}9˞+s7ÚpF+< GAkarQ,vy?-r%Γǜsy۸#W rIѴ+{wԪ`\qjm?Id/AqV`$BYnVdFI^=潮I*҃k⶗vr `?z\*_g,cgL qxE X]kSu͉+۽;D -2W'V4kD6 s4+ߵ[p5܉%) F8pywg0OK7icWE+hsg\9^*R>ngwv_NoLnu vnluk%=-p%O^WRI Wjwd f21rܿgɑ$yas}4K9!f.psg5߳E!x5a7^k̐ZBm8c+cg)Oj:]jJ7Ky˵ 6 Y?7yO iRD,ῥwrry[ש:gx%l6@Dci-x'Ɯ3e<}ʘisGtjMaùթpٻי?~(QBZyȥ2ͽoXt1_Ox}kψ͜G{4>"fY0ߑC5X\]LTi;[G9! LiQqJ4qݥu^<%36S ׵`Mqo(`1q[~&7}e#f]"+f6 _]NO>ɸs,Tj䎑.TF@F^^;ٳѴ->)$w)#Qo<5„fVc\ެ0sӿ)ψ:f w `'wX p)n(q_,|`5ɾ@|Uv-'aک?g[ı-b o?~HΟzC 9E5'#ՁˣGojV$\P$:1G +[VxD^?yCoi|L3 EvX~Ӹ's\x||QYJ;k=h15BO)F.yTo~g&[t^:rAjݳvOS~#yft#J| BH~%x?\j}y_1>c`k]a l>v#cܽoǟt=gLJS{!IDݹVn9:l} ~7wAJ[}9}Rv?|B`kkmeH "6x3TM_Lv`əA*c|G}AZ[Wm,~TQ5]yk>UuQ^jNL)oby w6CXY^tE6*Qiד~^Kn}1y&Iͤ0޵/eB^<#wq}63j/.HUnu EE.r%wN>.exNYwȳFi,9L%YV*%l)acN7< oRiv\19+/k~ r8 `ڍ5?|Ug?Hz6i{q" %D,ftjyO-XdX;{ ॄ\e.kA}kɄ&䤹_~gZtv^'ҢK8c]iWֿo_\]6O-̳GqE"D?onlaL;ָϊ) W?[B`?5$WU\>7j[=;qsNE#~> &TVM^pY-}Pqj{~v/A};[ti,6~Q}eWʶ博Ei,nL!劮kO'|K.̷h%X᱘?bet[3&aW wu+[ ?EȰ66\._O]k^)bt[Do,]#sBGxcQ,tS& ?46ؙX teiTF3QJZk2\,15Z*Fek)~٧_΅msuyh.3y?&cxo xįx #t_? 5 g_|I/-$2 871by⾮׋<#NEoj~U7H9;WvyQs:2斉%?C`_I|{kt}41 (긧6⹿–/=ķP_{ʑ;yn[>LC.8ްخztUe-mj>Ru假psd=Žw~KWF1}?4I;V.RBXIEaET[x<2'âEE@Rkqo%Ĉb'=ឧ$-$`S-Md3C^KX{HgZo2ns_ďá[~RY|CEPHv4/l?{{$w6ZF\,<̻p58f Ưz,%K'ZZ%m>T93Hcc=q_frJQOh-m[džMWkZUz14]'}lhO}>8u &K"Hv4lGO{w?>4ŏ+MA[}r3y R+m1_ZxwQiK <{|O[ *=OA}/U;afh+)r5|ESngf]Q˰5ɉI溂hs꿊Lx}fnlӤ 6֋$gW wI|j_u@گg[Vh ImćW;Wx5ҟ|;umq{l,k6?1V{@SnhLOVmX%7=q2V7.ܿN_e|i{j뵤_[~="Lce4xi TN/ k^Y >M9n5?Y3(SaM|>qJDӼW-?,1q|Ip-me6ª@e=wIhHʒ6e>cӥiEF6[:*sJɷ6K_`/ >5Ax} CС qUZ9axʚk~}KGtxFu.m3_| ץ޳mM`7zb3 $y,yåOH4; Slui&:eqn- nƽLX?zWާxwK>(yaiƤ_qi\g n tţbӚ7 aF ppI'Vda>La(/̠:Wb05*I3;+z8Z䕾> Ѫټ.. 2#+y{q˪%v<ؤeX4SJ:qP/vjNH#mnBHYFcN8ȯ/ V|,iSsJԼiBGdQ66Xm~ 4Ox6,[iWl׭䬘R8^pkɵĒL^ΟVREr4~a_GG_$S-یo_y|k(ȩ+|.I;J5#~]?Og kxLѭuJ&klIZ"3Oo뺃\ťcY%R?¾u/ črKXXO2Kio! }}~"­cGQM* 3A i] 뻚{z(IӇ^X旽Ӧ'7*Ҍs$av}ۻ)sl~[zjSH%c$b8<87{3K6ګ-׊:Myil*Yn.Zh"[xR_6a',UGێk*~ү,]jupn*xL+׏=M잗~/M'?m/ {t=[_c 8t,7mJĂ6h#ᧆ~eż?-mU&+o'oO-ᯃ5ɸ>iXtv>t$._=αQLkʳnb9\v=hef9?Eh~_fthq-L\~T:vЖAcZP&=ܣƞ%ξ> T,,o%c&UUq8bw'yidcaF*хN[Tڔz/.Uie7 Qd&#^pikyoϘF+[ռ=-ψG}nYIPᔳm99>7]$9gܟ3aWf_˥rb\n=biV5~uweKn̒6Vpjt/7}^GO.ƍatajX|wjIg7y .$^}Ė<f :[ۓ[y.-<σ4B],y0\>^?:7Øe{>-ԮMZIPdM)ޅURE|Q7|oߝĘ\ %v7dxZߴ^Tx,#4!}&m [+uZ~+R_V-ơ:Y|ّV?-qVhiY|-,hϢƺk,(Y|xmxaOzt_O3Em6ݿ,tVL+<[ Cgk>[G"Y/w0$k|V? Li&HΣnIvF񝵗oqRh|=-HR2tK1RTj{5Vg׫))IF+DFNއϞ-"73ٷL4wrO?Z{Eǂtv?v@yw$ЫD 7~Mnew~F>+x3bg Vrc 8-P\e%:- -Ӳlsvl_&#^IFay?/C㿋tLAw,8gl:qԚ鯩Clzzp erxcugn&}[Οƍ}[Kv6]Ȕż",$QOތ i;9VM³VR6j?Ė)^)h䉼F#o>9LWz- [/PJ% q^%(oˢM|G%ὕN~஫jZ,b짳?4q/GD9;`NGu*=:)\[nT(t.WtHڠX=Gx8#wmÌ>+6E#/|Z[rss֚m?Zf#{h@8hEfxgj%` 36qWȞv}`8鯻$p;IT݌[[v{c n cn; 8qZZ()5gܛ>#ajSgW؁8Xm)o985ĨFtq |kp㨮2Մ##:[1QZ"gm ßnAoB#jƥxH]ﹾn'R}q'X^a'\{bE!P$O)y}s\ =}JwFGi -';GS}skr ߷(Pd=d~r"Ctr9=~7gn?5.eCεoOb9Wb8lz9,sNX5XukG֧}sߚ|:{xH;Z0Bj嵨,$fY*]:,q=eqPGSr=|_g*[F[{D\ǯj-|BgoVmw t-Qoku9/cqU -ҿZYG쟝<6sķHmkwxCJvq%&<5xJ{E#EqeΛZHc"Þ %Nh|D.Uԅ";_aqv;Gکdn|IgcZrj9yc']iVMy0 vQj ]LpP,nG˲>gZPu劒rӫCTNMt+J[9“]ާoovШR5$UF ;Wo!JYru:kRN Ѯe&ӭMUލ3ٳ\ 5Ubg5F.5y~-fQBqSPa@Q47pq DJ EI9q:0WzZʹ;"bJ'8+VED+Y-ְѧVnnk!%o+ ppN9jMt9U#%ngS{3re=\ ѓrH>⽒NҖ¢Im͠ZxfX8҃%k3F*?i叩3nǍ_/ wL*MXi=@ɬ"9Pt=rLEI;&sFJ=,kk25sWmlLDXdͥd$e"nђ#o_i¹op,FISiӎM ^73dAѷ`9=Qoy!Gk襻M^Ջ(־#_ S-Z:䃴Mj XηN?*>pd3<6+Ճv]f"uuJjM5x3|;%VR0۹zu\OilۆTsEw[5jT8%%`g+éFש?y81SJkT x#XG9dⶵ}er,w^"F;!5ey]nDױ^j59+G]69T <(YHc+*If5+ j`6Lh(~+xc0Yqlxx_XoﳐOgiuhonz-|2_1_iNҮk.]pSnz|uq<2[ %s$c`95CB.!SS\~UʣSWg2Ԝ rN7i͹sK_QX]jO,rRC0UmU"xў# /i)_];G.L,Eݽ<=/,aY"bwnr1p]eGQV Ϳ |ox/$ᵑQ.YH*[Z/īʮHTo= auԋ%u":.]` aۻPӿjυz_5 h-u/W}]`lVe!^1Լ~3<}|7-F(^ s++Hߢ"۱w3n%xc>n冧woFv]aq^ =F >'5CW=ϛ fxm忎o$2v8Zm#cEQueo,~S~ڭ֯YYHV6ۗ52_R g v;]'ֽ(]bC_=>coN5/utRMr7Td'Ί¯yR\{3_񦇨\J&ț 3*)/%ŸgH;'3*)I#fa=+τRXvyQC:d2{WӍhE]UGeϧL3^פye$RQbLá%x/+]emvr68><9/^5Cn^tqF]p0kw*^6׈]h- Oi"̷ZME*w/Os޼x-g^gV/)i!uj:^Z;ٌO?xvn="H~$02G ds^6|8;s:<=k&,vc_OdjX9//[M P5+2/݅Ս@l:Əqow R#M'޼:~}k2{u-z//Xx W8x%Rn]RoKe+[>7|1Ko^9V4s`[6ݧ*O{WWWgjIEg;۩]CYѩjswIt$0Zt[큲J˅]F13x[B̫:?{U){?c%_Ŕ4x>G3(siUQ o7/!MA^56f6tl=4Mt ImIO|~uSzssIQ#'QdzfQp4WfeӴOEmx3}/A:SM t6~hizlZF~ ^Kgek[,kkg`(,Zdx\ۋht1A!N_W6_?m kZ/2 z+H\v(Zv%׽'sŊx:'mG2<ҩn|_kb]aW^e]wl+ sV2o\6!|q!Sڿjap:Rs*o{KCԮH#fs+T| . 4[+wffv !G5[jD\Wrw/t]vi<.*ƏR%KuTH~F^߯4K5MI$, %fq:esm%o'mb o+l]vaӧF1v 2F#7ӽjӝnm}o5Ιa UOL] 5n c)AWh$=.pZ5w'yˌn=:ƣK{«nX RUb`6:f·e߾is-}-";qy"0EU5 2C|=+~6TbxjOяߴ%zH^oV=V NX$+$Zޥy-)&_M~ Z_ˣ:h,_8ueFMV._("+ǧ>cቩSFKmyx~ !Zzd ^2E5{|ЉB]X9&1gf}I.K50<᷃ڿA>'x|ǪJ}, :î{^[iN"Yv,{zW!lp7OXT[ӫ%}4VO{A63"ܬ'pMš L·? /O2[cv-S8#c^7.Z.5/5"6syp" gT"Ꚍ_iQr?S{dy&n|Ym~ŝd@~񖳦MԒj4԰Vǘ ڿ #u|o`ҵFϙ{wI`g< ?ڳ֟ <3ZwZ v>:ت`ow*vf2yny^˹,0<]N3M;կnژ2:*nI/׷f|9i.xInԏq`^܍$WDU ~5xOޝk[4-]@˵C˞W¿]'< F5[dڿ.0cX)Χ(-5O]׭ypf(֍W:Ԩ<(kji\[+ݝm38 Zfo'a>iSI-L7His||`mEHLw*yl KdG$ﶫ6+'jѝ?{wVe;=eAVZegյht+Oԥ *՗~1pkĮ5Ӥfd8%/U+~ |,G=jK[@}yf]ɽW,#ǥgG/{VbZJh߯HO ZXZ-#W~1*7QnoR_5BƵN%˼6o0z1K ʻՌFz~<?V֯-ږBwHWu^Ҽ)>bܱ(b,+M4;)fXEV؏|{97{_[oo20R98.N;}ze_z4Wq]:=Tm*} ᦕ &{oXv I#8 |LWZӎ*50h3s_>3xk>Got;*M$h>okl j_hv@D̒۟Gk\&y}I{뭢Vz\KEKR GEפֿKϬ^,HT3HYX5^>\ڮ)H$Hyw~}ֳe]">OSʿ!h~ҬnM@Iү_+t-9jɰKk_S3ZF?X,/n/1_GlHڿcQuR ]άHp}Wi2Hc E|Jk*/G5 SQ_kOKEWQE=PqRIZװ鶻IۻO?gkP+O"+ZX,QG= +u=O׆u=~8-,ݣ,U?7͌t5 G%vl_1Iy/4#M22Gt*; s^xo!gTDwҿ$^8ba,=-!b5OM/u!Xr }ߗ "g [ 4Zq.H׈yX[I7-JoNz;_|7Đj54ς]ӥ" ]o5#S`G`yR>2ψ'†]7OZ'_uc^d^FUV]_4gڵ2(__恎()pzO Ґ 8PYȯZsPEN ٜ/|=Gnk﯇^EӷH zkx?QWCsf?gxưn#uWWz&z^#F9MYhr<+TһK_]PH-7H^{ r=^ gy2:סA-2IvR>\=ro$׭KW3Cǧi[Ar+^=WG~LҰA^s=x^r:֧Վs `~⸫#ºcӞ yh#鏭k*k˜:zV2)n'#`ն:JZ~U'+n'i=q#ecQ5 J0;YcZ𪍠vQ)$NdZqZg_ @^jUEmASeEgGSJֆvE^̳9R=ZfZ9t$x ֶ ^kH c 暪{$cM|y``WgV0ܠðnt'0֕x]sԊG&mnqdke 1Z޺ 7L޹*gɵ$̚OPqkO3MOQhb;Z Ichy^桩7V?>%Ve3<ٮRՃdy֑aR[Y 3aQy&|<=x7ǧ'50NsBk,*K/A:|⋐Npsg7rn+C0v0kCuC\MrInkVgf9nmIng/|xJúrPW7^ndv߹-rsz>ْ;NOVwoePI2!ZtౘSqH/_&*1to>wl+^կo)\ⱼtqW!\Jvwp43?ݴ|̪t!tSIWVBbnY֬ w[6mr<ȮN ۡ\_l")پE < :1w$g+R>^Wl\_f8 ڸNe[[ErznQh)P_.ZPhq֖je_8A]9(g Jn6ӛ趶ְHfwz]9\p9URY,a ܣnk:x6K8v#l0yJ|ߙY?Fd?`b_:7'KmgԒ+>)6N帽D] ¼__x[X <;kc>ŅDQN4}f\4'ڐ>QKxu{RۥLqՎ"S/F!fTm>z]|ۺ?~? 2XIi/F$fn uׅ.na޵egM' i&7wV~/"8ojxQYx#,麿sm2f_⎏܌ jW ie)yl;p~ο54?_7mmnI6|5Оx3s۽ƅƉ2"k_Tֺ%[yW*l^uuWծּэ*˺cr F3#V~)ɷ.9}^F>hg摔ڂߟ-^o-Gh~4v %_Y$T(S_AxW]_ڹYn-S-_O?R^ a06\[sPq%_1쟏tm۠HQ |kթER5ZgyDDz8?~Mo^-o=ŴF|_l$kZkOX[j;*<|<;\kVy&|aeks.m`(VFt +ˡȞaF5(7dSw}ދ~[ g?XRT,,du'<+GVżf;p|^00Mhk%Nfwas5-^ͦx%loo?/5Etm:ˉSׇڙN;1ŮI5j+oC1y~[K5:پdCQ[xMd]ijYw6 (H5n{uwpqֿ T𷉼IntKE۹{lڋy#pI)ݤvߢ*kך){}Biѡv/\~y&|K&oN6≮'EY&=uo żH#2?q<קo0&a!u8cM[lw3 >kAʲ"8N'Z|NME7Eͣ z~N-n|ǟVE9oUQ־.' smѼMiBx'xs­%d͎ϧ OJ E5O+|L!zM FE)#B>U?zM|k"R˩_Kj;FPm O![ύ>qtixP)naw MWf5e$2ru%.^kKӤ~ٯ5 (eƔN~VjRMFM79iʜW<#⟏|)⿊?i|<ܾ@RG5䷒]SbdnrzuA8ɍ_Cli+~11Φw?^Ct1oO%y7y_o#,%޾RnZf2 UT} N9(y3&]E|{Y/ʧi<"8c  o3IOV1].HM"sly/ɐ)Ey+E;\DFU)g@")>۽W9g̢΍jײQޗK{Vl:p "FۍU4WW*m7WUst@u O^/SiZ&cmKKM&cZn|-C0f5SW׭Ӳͣ;z)aOJCI+.4wQE S3@TsJX_bp󡉝S^*I?daMs{wG[p8|{9OR(Kʪպf)'Y Ҿ>' ?hI%z~  U6k87fԽg~8fS(֦6(N?3s{Mf=OH׭N=Ⰼu2N|[sSZZUlbU]#e?>7jv:"˧[,V!“lVyNGĿx7\"bySB.c%+=|vc'8rz?7Ws`\^ZvZfk?H8gu_|o iw`Ca eiR%ulg|6AB;];^'HJ̤{^?lU+$J'aogMFMOBj|CៃQ ϧ[j(>|"S.އ*}_̚5LZN[jVVq-uLQk]M{UCrة7RgJSnrwn_> me)&+nT]#NOc_-Z8YxqyN0`U =gHRWtՒK$VkeD黥mùLWrb~* |AwƤZGY2N[k[$sO 7ˎC^k#~jZ>uN2y`K˳\%3o8'7՝wQӾ>9oĹԲ|ӟVӧ[ֵk5M44ﯴ?yӱ¾/&3\FH W{"b.%P?S]aᴴ:*!7-|?;RGNm/X h ;r$nyh V,jc_J|%dЬD2&K5[Xtbb$g5)v[__ ΚqqM6ԛ~G'݈ G4lD=Ĩ_WJ_/k}_kkK.Ė9աO$v?vz4w2 YJ5Wnx~߉Zƫ[c$f}7 .F7Qȼj7]L7 P9m;Ӯ%rխցnd.ڄң[ȫ7ҕa]xs¬eD͸1yYYc9ZApZ7O|k<'iZՇcXmV_5.L{s_I-"e VYeDFi獣g foVd?~%WaZmքRٵ&7.Ɨt$4 5NMzFw2ok񧍭.ZcqJAoM!pc־Zm~6ڷ濦hi8ɻ, 2Gj߄ Yׇ~(-liS,a#iru(qXWJ\]5kmy8SflIrKKXdzkT.kW:JM>-"\+tqu+5jVZSvr$?WU'D18HoaZ^ h+.rWQ~߳w~)xV+7BT5D6fK-Kn#Jz2EGJv-͟蟂?E<~&ʬc5wK݄i>k˚S7nMx YbLHdb;@[#W7ïK~.x3IT-Wᰛf#_arG`K^W?;]sȰ 7ˤH#o@59'0i?-tG^lFsʜ!'/vI]Q|*K\%ƍh=P̵&6' ~X ;zo&tD`݆$n\u\/c/. ^ծ䅮v-N>>n+¼eUyYJȅ_!}koC$I-֨Z8d?1?]\4T-ӿ3V~;HR𞷡h{rsOL̺¿.yxɦjEeDtNkqf4R4o_罒Uyd3Wuoj|⿏am;J=#ʖr1_ɷ6~$PE><>⩣Hidu;x~jL?=g;W^5FeG"+[q_W S¾fK_6N_zßTQE~2ӇMɠiŕ{L5k:^A{yVz~s9e{9ؿ sGaove ip`H=}kγGCb?R_2塤)|+ߑV2n_ۣ^Cv?~cA0`|ռof9<|;h|l-dݵ*9#sV_QeK{;۵ter ¿qeS*nH9]Fhzsp圓~zo;Ke򬤎+lYmA,xvs5O6K|ho_x.Gg&R}3mDvH\kZO\ ;Az~gV^{o % tۃE-m+6U_ @+MnC}'Q7$0v5jFk[yt&(N~VJ?_S/8[^XZ_XZ$]b$,8;GSj a]4i[8,!3LHWs1'3^*x{gQ6<][_+WRTQ);ٽzpK'7[wgܲVM߼\=К D҆sݝy HT0xB6M1a՘ޘ5 }/nb:D~QsK]ǯ׏ F*ʜRJ56d:g 5yќF]?,{xT*6|b?ڶ6a5&  Y>^:KڔnEGr7[2ȬT0>jsmkk#K糄CDɍ~rws^ౘuT^5ܿhqتXE^T䵲vLmR>/Vtp @ay?sz_ߺ|DpY&fp#1T[z{gT¸m❶[CJTN:i'}FERE(jUVoW }7ydt7Aaas\fmc3t}5qiYpuq){IYxB|Yiڬe|[_P)pʟ.BW?+,pC)C+ټO%rfyU{MQC(E(lmE_+8m#n䙧9je-`cޛq{kf wՋsr=s;JNlqBem]ܪ5 I]W8+9]M#纃uSj5)1ҸK7dףA;xhsbϹ"+۸?:n9yR|V̙;z=Xn81>(a'ں_ɭ6.w\') W%G=:Wir^v*i#A+Xܱ,$,xqywv9Uz2d&GQѴQ(:Ew6+SsTAB2O]՝ϥuv, )b2Hn`gZzu7(8>xNɳZk= \Px@퓜EepWu'kpS9&uB q ϥmň8Px5ٸ#]9AY6i@ bOyv) u$85 ҥsuZ Cq9\ utlXt1DvԞUklkr \zU;tlqWAilPGCN9|LZbҭ0UVlzVͽ }:WM?3t𠀪$6qPKBd').l)8}+;9jxR1jpk۵M<$.8ڽ(8uEsԊ{+5:*O8<״3pGjA 1Һi#ί$g3NO_ n%^Պq^o}\3| nǑ:n.Cp;WąGUuyWjz$;0qԭi:v+egvs]E9${W9,m3~Mr]_}N:-4pzŦ p9[FNBuqҺw'4*- zfG:bD\˹opP sO۲;`,y: #;qG=3^/y*z)#p1+Uy?>6;>X]W6)YTVo:VuƐG '7}NF]#2*v,OF sڰ{Αr{ ~YOfqVGcx955V'o+׮܃8r[Fp9V8B%7c̫q<=TgF+xN -u<.˷7;TS#:U6 9WB┤w瓞njR߭Tަu'\UrHv[d}FjzqKԱS7>5Oyg^ڟ.ִmG8ZCsaZ v++Sބ195Z!>ɮHN[=j[U98a]-6GsSæ =.XeL \E ּ/Hm1C6_M2no1RCS#2,f_U*:rN vy ].cqF-*x@6v_x,|)=%ylU(=?:yۋi)^> 4]iFnm#+7͵q׭|Gkq,62)J6m3=g8 .5q, Nju.SZ7Xߖ9tԼ9yl>wݍɃVkx'JUD8\>,v?q p^[ 7;˞&FC8[Y2/jvgjLrLQ0+ҾBnL'.lvT㾩J+wѷiwO7O2|#ְ5 VC&B,׿VW~xZ/:S!Gt`ksZٝ*QT^gjХM C6#.X)R8VG ܯ}giY|,GUE]=S;?ϦɍFF3:+XdyM4W\F鵆EK;kC+;Wn_p7fW'}u[:(ma zK%u|G ki܃X^' %gk2\2J\EV6\o|>gBUε45ONmAY7[dkgn|˳9#uR,wVQpY|P3krxϯFn➌< Ж7Fi;{\ەNcxuN񝃜 zΕIz~Zs=Uq#Am&(PJ"VQo2ߣ1ȽRJD71>A9N.=#P 7c`9݌S|9l~JO! \k?ŵ6>ҿ9o0R+n㺜=b1+?XբehΝ/omɆ>ߋaխ$(f1ٟ}X̲7R<ھ<9-`!mqҿ#֝(G~?)p[[O0-R<^mTGC}_%͉,x_k#W⋐:r #|7b-oQc>p9+t*orsrNުֺg`ɬjc'ݑ5=N# ֎oD I7 >Ȼ*{zpޕXlv}+3f1ʕ;A?yfWj:9c |y[fy]r{^8fX"$wOJ4+F#`d 5|op*to{=0tP'8-Il~uxޯF9F_gw׶ZԦ|.S9?*dٖ _\_2ͪDEvt10o?INsb+{vhȡ^\އ^Nu J9|cRZHtQi2F9':~xsw[k"i"P*qCXۣmjL1mGK-{E}]Km}8ڠnn=yh_W-ݤ62b(XҐP3{W7L>a[[bH۟jֿYHm.-`uDqi-+?2/zVy%) L ڝ4,Oun4 + oɱq>Q=1|7'6866+:ݞ\DGgZ-ͽ†ߵs>KK{ˉ6'tyP;+ǩṫ{M5m3|m[WppcrƦ4_跶S'<mxWIlu/nmAX*zq^=c_WRY[.y&[1iL*6^Q~iFF?k@JO᷏Y-BŒKT,s,w_>X¿Z3엒6t,wь 2xL~^rVgapxݯ˯+~5|?>+x3LxPL˥ǺPF$y !R#Sf4rL{%*ь=\ZyC_._?G{"H ֤c#v|+o6&*E [:,w5H%\*pw/_}lM'< ˴Ӂ_G=N;+0}פ%]Q0A-!a>3ko%a4lv3LjwzQMcMSltmYʏο%<3ud> T]l'qljSpU$ms8J]OZ2+Gz/&{C2еYtmbN]2(&[ I=k+GWrSihi+nx.qqv2*rI迺7ŏ~q hׇS5il8G@r<ֵ4xV=^Ago"_#Y<.3ş 0<?mo]F-"V]'^PѪf7&ګa%J>TFm+i&^JWGO %N'~s :]ׂ,tN_[B2pQVLϸ_?Gc׼㻟+Ml!M4p\k=ޗ 4{x=+/E>&~^*/֭;^{,2#ޤl6EӞoSx¹uR⋩'R1p^O^ƣ?|<.qTᷯO¯N BڋmkwqJJLoNrNMB?h߆'Szߍÿ eE1֑ڿsi~9Ӯ-cCU&n^{x ji%=Hbo8ntdR-{I}G^>$ae,v^+ywꟑ O7jv-ܥr_7com ǭ}-ZgSg,VǢI?i-_k6;H+a"o`hg[bg^3`k}W,;ŗ?/' okAc-yK1ᰴkwh'kX8<(F0~Q2n0\Ҷ?<ۣ[sxrkrM .*a= ᑬڍŝ6.[[$_)򈕮$/~ymkmGM5XyYN3Z7/XMkd#>syq^2\QZyIs}Z4#-ˑtWP<5܊q+z+=9("/Isϭ~Q[ *҄o&e*k˒1\-E`Kۆ"~My{=\km:g1_h[#29ʺ;B!oeV\W5;cE柧kg[ئɥ8VII\Dq5r5\X:i}=Y5g E:ɻ^]M(ďF76}]V<3\H'7[؄e wu_hUDC խsg%:Uc+J~؟o <9iW4k]hyhVH́+iUTvpFX&%g6yl} I&7 pL+|ү(f;Nۭk ϐܖ^01_l-;I.Fwݝ> ^)t2>? .a('/5SOV𤹣|f\) 9zU:ܗi~Gqe+ʥV5og}q5(gU\dڶLo1n4L2io6y'$w,57k9]$-rYjj:'RЮԦ!-qh:-y끃\'t/ iL`0i[}@qXNtЍb0ᮨҫRSw|j~6<#S6Sۣ\z3߷SMXH뫽!5m>&[Lv/2K _cx ֞|3E.m%os_#ʦ9__D>ouuGO5Z*F*OўWӪB0;H1XˊA-GwȊrkvHP6E<ҭQI{p3+N8GQJzG[yl{>q${KV}s1[a-q(vۻھ6̓}kOD1%ż$jA_p&ya0")TtWm|2Z]?3;E9,s^iXVLxdf^ ,Ϸp6\^d0IF`$q_f8ҷ{W>x(Tb$ᖮڧ<@9 7ѯ+h}f+~"Ck) UZ= ڷ0hd2F{[$mvmp 9 [V;>9dq9e=x^mil:7E~WqaMV )GKݼ8U>IcD'c]H A_[9䧿GM{L7.& }=?.VB(Q"2̋nQ>`}{feV+@dEr5f].c#md>oʽOUii8^]儌FRQyL6\2Z3ws! PH&ZPn¥/toiV\Gq!,WGo$nI+pQcq+7ʿמ.a=aK;T58NQyy]u+U_j:𶗥Z(tx/$i@ _M}-IDlIsp@br{|,)kb1Uuv'd5pcY[Y.s^ᯊ$oeJKoLhi·oJߍ{egwi}s{Hm|tקvjS nb |=8xo?b}>x\U'cեl|(ŦNL6Lص-wᯈ?~gu$m s>Nv+񎃦iۈT8Q2<8>#ki؎8x _;ĸ~橣wX†3Ĺv"kK 85.Ooߴ/:4FIx6>Q&%f&i,,Io3~51+YMO 6SS\ԚuD4F*  oՐ?ٵ)>ʀˁo%N<ҾvO!+K), iUUE/vҵAuimHǔa2l> ~ ӤxnH >ksXzu2Wvҽ)o$bkc{_|\n^ŗԿvڔ+yMU)k}sԜR~K+хL^%8Sck\ g7j<FM eGg3Iot0<%KOPnef,1l_(jx&4ܭi1,;Fp~r- ȲѨ릊_O^7O5&[hۻttQO }+菊q_Euo:c6jSnVPxe=+ :P}:>D\|ۥ})iXF!_rVU7K%B3Z1,h_e?&--"dUjb|^3HռS.bs.Fgnqֿ1' j0J7m dwgLe&5~v;rج]KzŁm UĿ[kKNvq*5>-P Aۙ#A~暧8VRDI+X75/Գ*R業uVS#u֏ӮtbGIe_1mt iQVibo-NCvדF"pEk.W}mMYo4R^-;rǙ;r=OMwG׈5?ZxPn iƞЬ*ưquڸ;_V^Ss}ʻe*ݿy{"G|*S!pv7[YՈl]rۺ~Ýg R#G>nNY';s9FWS-̩{xQ+[ZWN1:~|xw+&gpeSJV1 p_;G־&Cw+<-izd=FcxcLtft/+TŐx[a&(˕#^IZd7{%"52(~C\>G`(Sy/m*rq4բ,j㰹/(`{5R1WR\׿}:.oZ޾ob$ҭ.|. `g3k?yZN5YwBJy-?i=rR׺?3ɑѳךχ fyU%*30⼬%crLJ4#ytӕ*kxIKpөJM{wSN[-i{\6ݽʿ1j_տl55mFq+OP\"-$ )Qʽ3_!O}=BvI0]̤c3jY:C3&v a &`276 Y:qo\U9+> oiGƲuE(F}zW.3aTPw);$uapexr-LW[˛)M[f_\wVPˣ[A@G~;:Oi\/sbf*J }k>i Ux^0N7Kס p\ꟑ}LjF&ۻlmek%KlL#y>Vsޣ8m|wzv^Y.'KFpƏ0R^8z1qԭ躞o&D[{lUoV+wMyqgqkp۲/BJ,vh3(`v~+X^{ $|+7VuN)aB)8mtƷ{V`OeB#"p NL2􀈳}< v ̒v6{^e^W5V4ú-qkocAy=&;~j.mbX uW֟ |;n0C-ij,V10\9a-orQd蕻 Yl_?D|;uh䲈"2v𞣭kDž]]hBcIϠjW3wMΑ{;hGfX.p ~tՎgVt6E}\|1G+%R"<Ѹr[}xqeN?u2˵<#:ȼ;Yddǖ_ =3_?(4iR nrm>+?4ԯ{Jh-41+,Epz#/3ͣKXdv$ <TNڒqm+8~&$0eLi}1闺0O\j>bͫpsҵF5WD`xk\z} ׭dO)=.Rx.s\͗>ȭKsxz)׏J셑Tn["ϷjҶ$Fj+BJy#0;Dа9Ak;f/M>В9ϥz~g N*CaےZҢ¡#cy z."vTS4Rk.6/A]}Pwt޹[% :fRmy$҃6h&d9 \3g